Table 1

The following primer pairs were used
Gene Forward (5'-3') Reverse (5'-3')
Mus β-actin GACGGCCAGGTCATCACTATTG AGGAAGGCTGGAAAAGAGCC
Mus Foxp3 (239 T cell) CTACCCACTGCTGGCAAATG GCCTTGCCTTTCTCATCCA
Mus Foxp3 (T cell) CCCAGGAAAGACAGCAACCTT TTCCACAACAAGGCCACTTG
Human 18S GCCCGAAGCGTTTACTTTGA TCCATTATTCCTAGCTGCGGTATC
Human IL-6Rα CATTGCCATTGTTCTGAGGTTC AGTAGTCTGTATTGCTGAGGTTC

Yang et al.

Yang et al. BMC Complementary and Alternative Medicine 2012 12:64   doi:10.1186/1472-6882-12-64

Open Data