Table 1

Primers for real time PCR

Gene

GenBank ID

5' primer sequence

3' primer sequence

localization


Bcap31

NM_009922

AAAGAATATGACCGCCTGCTAGA

AAGCCTTTACTCCTCCTTCTTGACT

761–847

Catenin

BC043108

CCTCCCCCACCCACATCTA

ACCCACACCCCACCGAgaa

4957–5049

Cnn1

NM_009922

AGTTGTTTGCTGCCAAGTCTGA

GGTGGAAGGCAGTTTAATGGAGT

2081–2168

Dlk1

D16847

CTTTTTGTGGTGGAGTTTGCTCTAT

gCGTGGTAGCATGGCACACA

1859–1950

eiF-4E

NM_010124

TGTGCTTGGCTGCTGAGAGA

ACGGACAGACGGACGATGA

1446–1531

Grn

X62321

CTACCTAAAGGGTGTCTGCTGTAGA

AGGAATCTTCTTTCGCAAACACTT

1630–1729

Grp58

BC003285

AAAACCAGAGAGGACAGAATGGATAA

TGTATTTTCAAACAGTGCAGCTAAGAA

1627–1712

GSTM1

NM_010358

TCTCCTTCCCGCTCCCTT

GAGAATGAAGGCTGTGTGGACTT

965–1047

GSTO1

NM_010362

GGCAAGAGCCCTCAGCAA

TGAGAAAGGAGCCAGTGAGAATACT

826–912

IFIT3

BC003804

TGTGGTGGATTCTTGGCAGTT

CTGCCTGTGCCCCAAAGT

1279–1366

LAMP2

NM_010685

TGGCACTGGCTTAATGCTGTT

GTGCTTTGGAGGTATCTCAATATGAA

3132–3218

Mafb

AF180338

CCATCTTGAGAAGGTAGCAGCAA

AAAGTTGGGCTTGGTGGGTT

3731–3840

Mpp1

U38196

AGATTGCCATCCTTGACATTGA

GTAGGTGCGATGAACACAATGAA

1301–1388

Pls3

NM_145629

CACACCCAGGCTCAAAGGA

TTGTGATAAAGATTTCCAAACAAACAA

2816–2902

Prss11

NM_019564

AGTCAACATTTGTCCCTTCCCTTA

GGCTGCGAGGACCTTCCT

1752–1837

Sirt1

AF214646

CCTGCATAGATCTTCACCACAaat

ACACTCTCCCCAGTAGAAGTACCATT

3016–3108

Smoc2

NM_022315

CCACTATGGGATGAAGGTTATGA

AGAAAGTGACAGCCAGCCATACA

2377–2465

SPRR2A

BC010818

ATAGCAACACTTCCATCCTCCTTT

TGAGGAGCCATCATAAGCACAT

379–471

SYN1

NM_013680

GTTCTAAAGTCATCGTTCGGTTCTTAA

TTCCCAGCTCTGTGATCATCAA

3334–3424

TMPRSS2

AF199362

AATCACACCAGCCATGATCTGT

AATCAGCCACCAGATCCCATT

1364–1473

Upk1a

AF262335

GGCAACTTCATCCCCATCAA

AGCAACCCTTGGTAAACAGGTAGT

580–652


Saban et al. BMC Physiology 2006 6:1   doi:10.1186/1472-6793-6-1

Open Data