Table 1

Details of primer sequences used in qPCR analysis

Gene of interest

Accesion numbers

Sequence of primers

Product size

Annealing temp (°C)


COL1A2

NM_000089

5' GGCACTCCAGGTCCTCAG 3'

5' CCACAGCACCAGCAACAC 3'

100

60

ALP

NM_000478

5' GCTGAACAGGAACAACGTGA3'

5' TCAATTCTGCCTCCTTCCAC 3'

117

60

OPG

NM_002546

5'GCAGCGGCACATTGGACATG

5'AGGATCTGGTCACTGGGTTTGC3'

135

60

β-ACTIN

NM_001101

5' GGACCTGACTGACTACCTC 3'

5' GCCATCTCTTGCTCGAAG 3'

135

60

GIPr

NM_000164

5' GACCAAAGGCTCATCTTGGA 3'

5' ATGTAGCCGCCTGAACAAAC 3'

114

60

GLP-1r

NM_002062

5' TGGACCAGGAACTCCAACAT 3'

5' TTTGGATACCACGATGCAGA 3'

114

62.5

GLP-2r

NM_004246

5' TTCCTTTATTGGGCGTTCA 3'

5' CTCTCCATTGGCAAAACCA 3'

155

60

GHSr 1a

NM_198407

5' GCACTCTTCGTGGTGGGCAT 3'

5' GATGAGCAGATCGGAGAAGG 3'

123

60.5

GPR39

NM_001508

5' GCTCATGAAAAGCCAGAAGG 3'

5' CATGATCCTCCGAATCTGGT 3'

172

60


Pacheco-Pantoja et al. BMC Physiology 2011 11:12   doi:10.1186/1472-6793-11-12

Open Data