Table 2

Characteristics of 13 microsatellite loci in Grapholita molesta
Locus GenBank number Primer sequences 5 - 3 Size range Number of alleles Null allele frequency1 Ta (°C)
GM02* HM177460 F: CTCAGACCTGAGGGAACGAC 75-117 19 0.17 56
R: CAACACACAGTAAGTTGAGTTTTGTC
GM05* HM177463 F: CAAGCAGTAATCGCAAACATC 150-222 28 0.25 56
R: TGAGGACCAAGATGGTAGACAC
GM07* HM177465 F: GCAGGAAGCGATACTGCAAC 82-94 7 0.07 50
R: GAAGCATCGAACCTTGTCG
GM10* HM177468 F: GTAGCGTTGACAGGCGTTG 158-202 24 0.13 50
R: TGCGTTTACTTAGAGTATCTGTGC
GM11 KC573059 F: GATCGCCGAATCAACTTCCC 213-295 19 0.24 56
R: CACAATACTAAGAGTAGGATCTAGTGC
GM12 KC573060 F: GACCTAGTTAGAGTCGCGGG 212-240 8 0.27 56
R: CAAGGAGTTGGGTTGGTTGG
GM13 KC573061 F: ACACTTCTTCATTTTATCCGTCTC 113-145 9 0.21 56
R: TTATACGAAATAGACATGTGTGGG
GM14 KC573062 F: GCAGTGGACGTCTTAACGC 131-163 9 0.18 56
R: TGTAGGTACTTGACTTCCAAATGC
GM15 KC573063 F: CCTACCTCTACTAGTCACACCC 140-166 16 0.05 56
R: CGCGTGGAGTAACCTTGAAC
GM17 KC573064 F: CGACATGTGGAACTGTCTAAC 230-292 18 0.33 56
R: TCCTCTGAGAAATCGCACCG
GM18 KC573065 F: GGAGTTCATCAAGTCTCAGCG 108-140 8 0.25 56
R: ACTTTGCTCCCTTCGTATAGC
GM20 KC573066 F: GTACCTACAGATCTCACAAGTATTAAC 196-248 23 0.27 56
R: GAAGAACCATGTACGGCAGG
GM21 KC573067 F: AAAGTGATGTCGTCCGTGAG 193-255 27 0.33 56
R: TGCATAACGTGTGTAAGAAAGTG

1Estimated in Geneland.

F: forward primer, R: reverse primer, bp: base pairs, Ta: annealing temperature.

*from [18].

Kirk et al.

Kirk et al. BMC Ecology 2013 13:12   doi:10.1186/1472-6785-13-12

Open Data