Table 1

Primers used for mutagenesis

Primers

Sequences a

Tm pp (°C)b

Tm no (°C)c

Usage d


3026L/MF

5'CTTCTAGAATTATGAAGATAAAAGGAATAAAAAGAATAGTAGTAC3'

41.1

47.5

26L/M

3026L/MR

5'TATCTTCATAATTCTAGAAGCTATTTTGTTTTGTTCTTTAGCTTG3'

41.1

50.5

26L/M

3051L/MF

5'ATAAGGTATTCGATGACAATACACAGTCAAAACAACTTCAG3'

45.6

51.7

51L/M

3051L/MR

5'TTGTCATCGAATACCTTATCTTTCCATCCTGTGGTACTG3'

45.6

52.5

51L/M

3327L/MF

5'AATATTATTTTTATGGTTGAACCTCAAATCTTGTTTTATGCAAAA3'

43.4

49.3

27L/M

3327L/MR

5'TTCAACCATAAAAATAATATTCTTGGTTATTATATCTTTTATATCTTTTTT3'

43.4

48.5

27L/M

3356L/MF

5'GATAGTAGGATATATGGAAATTGCAGAAAAACATTATCGTTTG3'

43.5

51.5

56L/M

3356L/MR

5'ATTTCCATATATCCTACTATCCTATTTCTCTTTTTTGCATAAAACAAG3'

43.5

51.2

56L/M

FabH2111C/AF

5'GCCGCCGCCACCGGCTTCGTCTACGGCCTGGCCAG3'

50.3

60.2

111C/A

FabH2111C/AR

5'GCCGGTGGCGGCGGCGGACAGGTCGAACGCGAGC3'

50.3

60.0

111C/A

FabH2111C/SF

5'GCCGCCTCCACCGGCTTCGTCTACGGCCTGGCCAG3'

50.0

60.2

111C/S

FabH2111C/SR

5'GCCGGTGCAGGCGGCGGACAGGTCGAACGCGAGC3'

50.0

60.0

111C/S

VRARN3F

5'TTTTCAGGGCAAAGTATTGTTTGTGGATGATCATGAAATGG3'

45.0

54.5

N3/D

VRARN3R

5'ATACTTTGCCCTGAAAATACAGGTTTTCGGTCGTTGGGATG3'

45.0

59.6

N3/D

VRARC5F

5'TATGCATTCCAATAGGGATCCGAATTCGAGCTCCGTCGAC3'

49.0

58.1

C5/D

VRARC5R

5'GATCCCTATTGGAATGCATAGATAACAGCTTGTGTTCTATCTTGCAC3'

49.0

56.7

C5/D

VRARIHISF

5'CATAATTTAATTCAAAAGCACCATCACCATCATCACTGAGAATTCGAGCTCCGTCG3'

44.6

56.8

CT/I

VRARIHISR

5'GTGCTTTTGAATTAAATTATGTTGGAATGCATAGATAACAGCTTGTG3'

44.6

55.9

CT/I

VRARDHISF

5'GTTTAAGAAGGAGATATACATATGACGATTAAAGTATTGTTTGTG3'

43.8

50.7

NT/D

VRARDHISR

5'TGTATATCTCCTTCTTAAACTTAAACAAAATTATTTCTAGAGGGGT3'

43.8

51.3

NT/D


a: Primer-primer overlapping sequences are in italic. The sequence insertion is in bold face.

b: Tm pp (°C) was calculated from the primer-primer overlap sequence.

c: Tm no (°C) was calculated from the primer sequence matched to the template.

d: N3/D: three amino acids deleted from the N-terminus; C5/D: five amino acids deleted from the C-terminus: NT/D: N-terminal His tag and TEV protease recognition site deleted and CT/I: sequence encoding 6 × His tag inserted onto the C-terminus.

Liu and Naismith BMC Biotechnology 2008 8:91   doi:10.1186/1472-6750-8-91

Open Data