Table 3

Primers used for real time PCR analysis

Genes

Primers


RPL13a (reference gene)

Forward : atccctccaccctatgacaa

Reverse : gccccaggtaagcaaactt

cFOS

Forward : gggacagcctttcctactacc

Reverse : gatctgcgcaaaagtcctgt

cJUN

Forward : agggacccatggaagttttt

Reverse : tttttctaggagttgtcagattcaaa


Bougault et al. BMC Biotechnology 2008 8:71   doi:10.1186/1472-6750-8-71

Open Data