Table 4

cDNA targets and PCR primers.

Acronym

Locus Tag

5' Primer

3' Primer

Size (bp)

Amplicon%GC


LAM

LAMCG

K7B: CTGCTGGCCGGAACTAATGAATTTATTGGT

K12: ATGCCACGATGCCTCATCACTGTTG

150

50.0%

K23: TCTGGCTACGTCCTGATGCAGGG

K30 : TTCCTGAGACAATACAGCACGACCGCTG

150

CHS

AT5G13930

K3: CACGACAGGAGAAGGGTTGGAGT

K4: GCGTAGGTAGGTAGGCAGATAGAAGGC

132

53.0%

SE

AT2G27100

K3: AGCTACCAAGACCTAGATGCTCCAGAG

K2: CGGGATCTCTCTAGCCCTGTCTTGT

88

48.9%

PHB

AT2G34710

K3: TCAAGCATGGGAAGGATGGTATCTTACGA

K2: AAGCTAAGCAGTGGTTTGATTCATCGTCTTCA

85

45.9%

EMF2

AT5G51230

K3: GGAGAGTGTTTATGGTGAAACTGTGGAACC

K2: GGAGCTGTTCGAGAAAGGTATTACAGTTGTTC

87

47.1%

NPR1

AT1G64280

K1: GAAATTCGTCCCTGACAGATTCGACTTCT

K4: CACTAAGAGGCAAGAGTCTCACCGAC

110

48.2%

ANT

AT4G37750

K3: CGGATCAAATATGGGCGGAAATATGAGTCCTT

K4: TCAAGAATCAGCCCAAGCAGCGAAAAC

118

48.3%

FLF/FLC

AT5G10140

K3: CACCTGCTGGACAAATCTCCGACAA

K4: TCATAATTATATATGTTTTGGATTTTGATTTCAACCGCCG

107

40.2%

HAP3C

AT2G37060

K3: GATTACGCCGCCCAGCTCAAGA

K4: GCGATGGAAGAATTTTAATTATCTGGCGAGGATTTAGG

122

45.9%

ABI3

AT3G24650

K3: CCCACCGTCGTCAGCAGCTAC

K4: TCATTTAACAGTTTGAGAAGTTGGTGAAGCGAC

115

47.0%

AP3

AT3G54340

K3: CCATGGCCTTCATGCACCCTCT

K4: ACTAAATAATTAGATAGACAATGATGGCACCAGCAAACC

110

40.0%

LEC2

AT1G28300

K3: TCCTCAATGACACCTGAGGATCACG

K4: GGGTTATGAACTTGAGAACTTCCACCACCATA

113

48.7%


Rutledge and Stewart BMC Biotechnology 2008 8:47   doi:10.1186/1472-6750-8-47

Open Data