Table 1

Primers used in this study

Primer Name

Target Amplified

Size of Product

Primers (5'-3')


RAPD-1

Random

CCACAGCAGT

RAPD-2

Random

AAGCCCGAGG

1-F

Chloroplast

1700 bp

AAAACCCGTCCTCAGTTCGGATTGC

1-R

CCGCGTTGTTTCATCAAGCCTTACG

2-F

Chloroplast

1900 bp(LTB)

CTGTAGAAGTCACCATTGTTGTGC

2-R

2200 bp (bar)

TGACTGCCCACCTGAGAGCGGACA

Bar-F

Bar

550 bp

CGAGACAAGCACGGTCAACTTC

Bar-R

AAACCCACGTCATGCCAGTTC

LTB-F

B subunit of E. coli heat-labile enterotoxin

380 bp

ATGGCTCCCCAGTCTATTACAG

LTB-R

CTAGTTTTCCATACTGATTGC

PEDV-F

Porcine epidemic diarrhea virus

420 bp

TCTATGGTTACTTTGCCATC

PEDV-R

AATTAAACGTCTGTGATACC

Ure-F

A and B subunits of Helicobacter pylori urease

2450 bp

GCCACCATGAAACTCACCCCAAAAG

Ure-R

GGTACCCTAGAAAATGCTAAAGAGTTG

IFN-F

α-Interferon

580 bp

ATGGCCTCGCCCTTTGCTTTAC

IFN-R

CTCTTATTCCTTCCTCCTTAATC


F, forward primer; R, reverse primer

Kang and Yang BMC Biotechnology 2004 4:20   doi:10.1186/1472-6750-4-20

Open Data