Table 2

Primers used to sequence codons in p53 and K-ras2 that experience a high incidence of mutation during carcinogenesis. The designations "for" and "rev" indicate whether the anti-sense or sense strand was sequenced, respectively.

Primer Name

Sequence


p53 c175 pos1 for

gcacatgacggaggttgtgagg

p53 c175 pos2 for

gcacatgacggaggttgtgaggc

p53 c175 pos3 for

gcacatgacggaggttgtgaggcg

p53 c175 pos3 rev

cagcgctcatggtggggggca

p53 c175 pos2 rev

cagcgctcatggtggggggcag

p53 c245 pos1 for

gtaacagttcctgcatgggc

p53 c245 pos2 for

gtaacagttcctgcatgggcg

p53 c245 pos3 for

gtaacagttcctgcatgggcgg

p53 c248 pos1 for

cctgcatgggcggcatgaac

p53 c248 pos2 for

cctgcatgggcggcatgaacc

p53 c248 pos3 for

cctgcatgggcggcatgaaccg

p53 c249 pos3 rev

gtgatgatggtgaggatggg

p53 c249 pos2 rev

gtgatgatggtgaggatgggc

p53 c249 pos1 rev

gtgatgatggtgaggatgggcc

p53 c273 pos1 for

gacggaacagctttgaggtg

p53 c273 pos2 for

gacggaacagctttgaggtgc

p53 c273 pos3 for

gacggaacagctttgaggtgcg

p53 c282 pos1 for

gtgcctgtcctgggagagac

p53 c282 pos2 for

gtgcctgtcctgggagagacc

p53 c282 pos3 for

gtgcctgtcctgggagagaccg

kras c12 pos1 for

aacttgtggtagttggagct

kras c12 pos2 for

aacttgtggtagttggagctg

kras c12 pos3 for

aacttgtggtagttggagctgg

kras c13 pos3 rev

gtcaaggcactcttgcctac

kras c13 pos2 rev

gtcaaggcactcttgcctacg

kras c13 pos1 rev

gtcaaggcactcttgcctacgc

kras c61 pos1 for

atattctcgacacagcaggt

kras c61 pos2 for

atattctcgacacagcaggtc

kras c61 pos3 for

atattctcgacacagcaggtca


Butz et al. BMC Biotechnology 2003 3:11   doi:10.1186/1472-6750-3-11

Open Data