Table 1

Primers used to polony amplify p53 and K-ras 2 exons bearing mutational hotspots from pancreatic cancer cell line genomic DNA.

Primer Name

Sequence


p53 exon5 forward

tgccctgactttcaactctgtctccttcctc

p53 exon5 reverse

ccagacctaagagcaatcagtgaggaatcagaggc

p53 exon7 forward

gttatctcctaggttggctctgactgtacca

p53 exon7 reverse

gtggatgggtagtagtatggaagaaatcggt

p53 exon8 forward

ggtaggacctgatttccttactgcctcttgc

p53 exon8 reverse

gataaaagtgaatctgaggcataactgcacc

kras exon1 forward

tggtggagtatttgatagtgtattaaccttatgtg

kras exon1 reverse

agagaaacctttatctgatatcaaagaatggtcctg

kras exon2 forward

tgaagtaaaaggtgcactgtaataatccagac

kras exon2 reverse

taatgtcagcttattatattcaatttaaacccacc


Butz et al. BMC Biotechnology 2003 3:11   doi:10.1186/1472-6750-3-11

Open Data