Table 1

Primer sequences used for qRT-PCR analysis of neuronal maker proteins
Neuronal markers Forward (5 → 3) Reverse (5 → 3) GenBank accession no.
NSE AACGCGGGAACATCTCATTC CGAGGTGTTCTGGGTGACTTG BC_031739
Tuj1 ACCCCGTGGGCTCAAAAT CCGGAACATGGCTGTGAACT NM_023279
NF68 GGTAGCCGCCATCAGCAA CACGCGCTCGATGAAGCT BC_029203
MAP2 CCTGGTGCCCAGTGAGAAGA GTCCGGCAGTGGTTGGTTAA BC_051410
GFAP GCTGGAGGGCGAAGAAAAC GCCTTCTGACACGGATTTGG BC_139358
GAPDH AGGTTGTCTCCTGCGACTTCA CAGGAAATGAGCTTGACAAAGTTG NM_008084.2

Jeon et al.

Jeon et al. BMC Biotechnology 2012 12:61   doi:10.1186/1472-6750-12-61

Open Data