Table 1

Details of the primers used in the LAMP-BART and RT-PCR amplifications

Primer Type

Orientation

Target (5' base)

Primer Sequence (5'-3')


Displacement

sense

ADH1 (7)

CTTTGGATCGATTGGTTTC


Displacement

antisense

ADH1 (287)

CCCAAAATTACTCAACG


LAMP

sense

ADH1 (116)

GGTGATCAAGTGCAAAGGTC

    TTT
TCATAAACCAAGATTAGTCAGATCAAG


LAMP

antisense

ADH1 (94)

CCCCTCCGCAAATCTTCGAACAGT

    TTT
GTAACTGGTGAAGGACTGAG


LOOP

sense

ADH1 (68)

CGCCTTGTTTCTCCTCTGTC


LOOP

antisense

ADH1 (136)

CCAAATCATCCACTCCGAGAC


Displacement

sense

CaMV-35 S-p (7214)

AGGAAGGGTCTTGCG


Displacement

antisense

CaMV-35 S-p (7404)

ATAAAGGAAAGGCCATCG


LAMP

sense

CaMV-35 S-p (7317)

GTCTTCAAAGCAAGTGG

    TTTT
GGATAGTGGGATTGTGCG


LAMP

antisense

CaMV-35 S-p (7296)

TTCCACGATGCTCCTCGT

    TTT
CCTCTGCCGACAGTGG


LOOP

sense

CaMV-35 S-p (7274)

TCCACTGACGTAAGGG


LOOP

antisense

CaMV-35 S-p (7350)

GGGGTCCATCTTTGGG


Displacement

sense

NOS-t (1850)

CGCGATAATTTATCCTAGTTTG


Displacement

antisense

NOS-t (2053)

CGTTCAAACATTTGGCAAT


LAMP

sense

NOS-t (1962)

GCATGACGTTATTTATGAGATGGG

    TTT
TCGCTATATTTTGTTTTCTATCGCG


LAMP

antisense

NOS-t (1947)

CATGCTTAACGTAATTCAACAG

    TTT
TTGAATCCTGTTGCCGGTC


LOOP

sense

NOS-t (2007)

GATTAGAGTCCCGCAATTATAC


LOOP

antisense

NOS-t (1925)

AAATTATATGATAATCATCGCAA


PCR

sense

ADH1 (1297)

AATTTTGGGGAAAGCTTCGT


PCR

antisense

ADH1 (1369)

TTCACCACGATTGCAGGATA


PCR

sense

CaMV-35 S-p (7133)

GATTCCATTGCCCAGCTATC


PCR

antisense

CaMV-35 S-p (7215)

CAACGATGGCCTTTCCTTTA


PCR

sense

NOS-t (1854)

TCGTTCAAACATTTGGCAAT


PCR

antisense

NOS-t (1885)

AAGACCGGCAACAGGATTC


Underscored bases of the LAMP primers are additional foreign nucleotides, introduced to link different homology segments (CAMV-35 S-p LAMP primers contain four linker bases, while the other LAMP primers only contain 3 linker bases)

Kiddle et al. BMC Biotechnology 2012 12:15   doi:10.1186/1472-6750-12-15

Open Data