Table 1

Primers used in the cloning or mutagenesis experiments

Primer name

Primer description

Primer sequence


pGEMHEStartRev

Reverse primer for pGEMHE vector with start codon

CATGGCCAAAGTTGAGCGTTTATTCTG

pGEMHEStopFwd

Forward primer for pGEMHE vector with stop codon

TAAACCAGCCTCAAGAACACC

p3X14startRV

Reverse primer for p3xFlag-cmv-14 vector with start codon

CATGGTGGCGAATTCGCGGCCGCAAGC

p3X14endFW

Forward primer for p3xFlag-cmv-14 vector

GGATCCCGGGCTGACTAC

CHRNA9Startez

Forward primer for CHRNA9 cloning into pGEMHE

CTCAACTTTGGCCATGAACTGGTCCCATTCCTGCAT

CHRNA9Stopez

Reverse primer for CHRNA9 cloning into pGEMHE

TCTTGAGGCTGGTTTAATCCGCTCTTGCTATGATCAAA

CHRNB2qk5

Forward primer for CHRNB2 cloning into pGEMHE

GCTCAACTTTGGCCATGGCCCGGCGCTGCGG

CHRNB2qk3

Reverse primer for CHRNB2 cloning into pGEMHE

TTCTTGAGGCTGGTTTACTTGGAGCTGGGGGCTG

CHRNA4_qk5

Forward primer for CHRNA4 cloning into pGEMHE

GCTCAACTTTGGCCATGGAGCTAGGGGGCCC

CHRNA4_qk3

Reverse primer for CHRNA4 cloning into pGEMHE

TTCTTGAGGCTGGTTTAGATCATGCCAGCCAGCC

ECSM2_qk5

Forward primer for ECSCR cloning into pGEMHE

GCTCAACTTTGGCCATGGGCACCGCAGGAGC

ECSM2_qk3

Reverse primer for ECSCR cloning into pGEMHE

TTCTTGAGGCTGGTTTAAAGAACCTTCTCTGCTGAGAG

HEstartFW-p3X14

Forward primer for ECSCR cloning into p3xFlag-cmv-14

CGAATTCGCCACCATGGGCACCGCAGGAGC

HEendRV-p3X14

Reverse primer for ECSCR cloning into p3xFlag-cmv-14

AGTCAGCCCGGGATCCAAGAACCTTCTCTGCTGAGAG

ZACNqk5

Forward primer for ZACN cloning into pGEMHE

GCTCAACTTTGGCCATGATGGCCCTATGGTCCCTG

ZACNqk3

Reverse primer for ZACN cloning into pGEMHE

TTCTTGAGGCTGGTTTACAGTCTAGGCCGCCTGC

APBB1qk5

Forward primer for APBB1 cloning into pGEMHE

GCTCAACTTTGGCCATGTCTGTTCCATCATCACTGAG

APBB1qk3

Reverse primer for APBB1 cloning into pGEMHE

TTCTTGAGGCTGGTTTATGGGGTATGGGCCCCCA

HTR3A5P381_5A5

Forward primer of HTR3A for 5 Pro mutated to Ala

CGCTGCCGCAGCAGCTCGGGAGGCCTCGCTG

HTR3A5P381_5A3

Reverse primer of HTR3A for 5 Pro mutated to Ala

GAGCTGCTGCGGCAGCGCTACATCTGTCCCTCGGG

pLXSN3'fwd

Forward primer for pLXSN vector

GGATCCGGCTGTGGAATGTG

pLXSN5'rev

Forward primer for pLXSN vector

GAATTCCGGCGCCTAGAGAA

Akt3v1&2Start

Forward primer for Akt3v1 & v2 with Kozak sequence

CTAGGCGCCGGAATTCCATCATGAGCGATGTTACCATTGTG

Akt3v1StopRev

Reverse primer for Akt3v1 cloning into pLXSN

TTCCACAGCCGGATCCTTATTCTCGTCCACTTGCAGAGTAG

Akt3v2StopRev

Reverse primer for Akt3v2 cloning into pLXSN

TTCCACAGCCGGATCCTTATTTTTTCCAGTTACCCAGCATGC

β2β4N_Rv

Reverse primer for vector along with N-terminal cDNA

GATGATGAGGTTGATGGTGTAG

β2β4C_Fw

Forward primer for insert amplification

CATCAACCTCATCATCCCCTG

β2StopRv_HE

Reverse primer for C-terminal β2 insert amplification

CTTGAGGCTGGTTTACTTGGAGCTGGGGGCTG

β4StopRv_HE

Reverse primer for C-terminal β4 insert amplification

CTTGAGGCTGGTTTAGTCACGCTGGGCAGCGT

AChBPins1Fw

Forward primer for AChBP insert1 to α7 nAChR

    CCCGGCCCCACCAAG
GACGACCCCCTGACCGTGACCCTGGG

CTTCACCCTGCAGGACATCATGGACGTGGATGAGAAGAAC

AChBPins1Rv

Reverse primer for AChBP insert1 to α7 nAChR

CTTGGTGGGGCCGGGGTACATGGGGCTTCTGTTGAACA

GGTCGCTCTTCAGTCTCATCTGGAACTCGCCTTGCAGG

AChBPins2Fw

Forward primer for AChBP insert2 to α7 nAChR

    TGTGGGACCCCAACGA
GTACGGCAACATCACCGACTTCAGA

ACCAGCGCCGCCGACATTTGGAAACCAGACATT

    CTTCTCTA

AChBPins2Rv

Reverse primer for AChBP insert2 to α7 nAChR

TCGTTGGGGTCCCACATCAGGCTGTTCAGCTTCCATCTCT

GCTGCTCGTAGTACACGGTGGTTAAAACTTGGTTCTTCTC

AChBPins3Fw

Forward primer for AChBP insert3 to α7 nAChR

    TCGCCGTGGTGACCCA
CGACGGCAGCGTGATGTTCATCCCCG

CCCAGAGACTGAGCTTCATGTGCTACATCGATGTACGCTGG

AChBPins3Rv

Reverse primer for AChBP insert3 to α7 nAChR

TGGGTCACCACGGCGATCTGGGGGCTCAGCACCTGCACGGGTC

TGGTGCTGCTGTAGGCGGTAATGTCTGGTTTCCAAATGTCGG

AChBPins4Fw

Forward primer for AChBP insert4 to α7 nAChR

    CTTCGAGATCGACCTG
AAGACCGACACCGA

CCAGGTGGATATCAGTGGCTATATCCCCA

AChBPins4Rv

Reverse primer for AChBP insert4 to α7 nAChR

CAGGTCGATCTCGAAGCCGCTGTACACCCAGCTG

CCGAACTTCACGGCGCAGTGCTGCACATCAAAGG

AChBPins5Fw

Forward primer for AChBP insert5 to α7 nAChR

    TACAGCTGCTGCCCCG
AGCCCTACATCGACGTGAA

CCTGGTGGTGAAGTTCCGCCGCAGGACACTCTAC

AChBPins5Rv

Reverse primer for AChBP insert5 to α7 nAChR

CGGGGCAGCAGCTGTAGTGCTGCACCTGTCTGGTCT

GGGTGGCGCTCAGGATGTCCCATTCTCCATTGGGGA


Li et al. BMC Biotechnology 2011 11:92   doi:10.1186/1472-6750-11-92

Open Data