Table 1

Primer sequences used for RT-PCR.

Gene

Sense Primer

Antisense Primer

PCR Product


ABCG2 [GenBank:NM_004827]

AAGCCATTGGTGTTTCCTTG

CCTGAGATCCTGAGCCTTTG

124

AR [GenBank:NM_000044]

GCAGAGTGCCCTATCCCAGTC

GGCAGTCTCCAAACGCATGT

101

BMI-1 [GenBank:NM_005180]

AAGTCTTGCCTGCTTTCCAA

CAGCGGTAACCACCAATCTT

316

PECAM1 (CD31) [GenBank:BC051822]

TGGGCCACAATCGCCTTGTCCT

TCCACATCAGCCCCACCGGAAT

130

PROM1 (CD133) [GenBank:NM_006017]

GCGTCAAGATACTTCAACGCACAGGG

CAGCTATCAATGTTGTGATGGGCTTGTC

650

NES [GenBank:BC108285]

CCTTCTCCAAGGAAACAGGGTCA

ATTTGAGGACCTGGGGACTGAGGCAC

428

RPL13a [GenBank:BC014167]

CCGAGAAGAACGTGGAGAAG

CTTTCAAGCAACTTCCGGAG

240

TERT [GenBank:NM_003219]

TTTGGCCGAGGCCTGCATGT

TGGTGGGGGTGGAAGGCAAA

252


Pascal et al. BMC Urology 2007 7:6   doi:10.1186/1471-2490-7-6

Open Data