Table 1

Primer sequences
Gene Forward primer Reverse primer
GAPDH CCCCGGTTTCTATAAATTGAGC CACCTTCCCCATGGTGTCT
ACTB CCAACCGCGAGAAGATGA CCAGAGGCGTACAGGGATAG
PTGER1 ATGGTGGTGTCGTGCATCT CGCTGCAGGGAGGTAGAG
PTGER2 CCACCTCATTCTCCTGGCTA AGGTCCCATTTTTCCTTTCG
PTGER3 ATCATGTGCGTGCTGTCG TGCAGTGCTCAACTGATGTCT
PTGER4 CTCCCTGGTGGTGCTCAT GGCTGATATAACTGGTTGACGA
PTGFR GGGATCTACAGCCAGACCAG GTGTCCTATGTCCTCCAAACG

Oll et al.

Oll et al. BMC Urology 2012 12:35   doi:10.1186/1471-2490-12-35

Open Data