Table 2

Target gene primer sequences use for qPCR

Gene

SCS

Efficiency (%)

Sequence


COL1A2

XM_001492962

-3.31

100.5

5'GCACATGCCGTGACTTGAGA3'

3'CATCCATAGTGCATCCTTGATTAGG5'

COL2A1

NM_001081764

-3.21

105.0

5'TCAAGTCCCTCAACAACCAGATC3'

3'GTCAATCCAGTAGTCTCCGCTCTT5'

COL3A1

XM_001501719

-3.22

104.6

5'ACGCAAGGCCGTGAGACTA3'

3'TGATCAGGACCACCAACATCA5'

COL10A1

XM_001504101

-3.39

97.4

5'TGCCCAGTGGACAGGTTTCT 3'

3'GTCTTTTCGTTTCTAGTCAGATTTTGAA5'

COMP

AF325902

-3.42

95.7

5'GGTGCGGCTGCTATGGAA3'

3'CCAGCTCAGGGCCCTCAT5'

DCN

AB106279

-3.31

100.1

5'CATCCAGGTTGTCTACCTTCATAACA3'

3'CCAGGTGGGCAGAAGTCATT5'

TNC

XR_035757

-3.36

98.6

5'GGGCGGCCTGGAAATG3'

3'CAGGCTCTAACTCCTGGATGATG5'

TMD

AB059407

-3.38

97.4

5'ACGTGACCATGTATTGGATCAATC3'

3'CACCATCCTCCTCAAAGTCTTGT5'

SIX1

XM_001492786

-3.23

104.0

5' GATGCCCCAATGTTTGTGATG3'

3' AGGAGGCATTGCTGACAATCTT5'

SCXB

NM_001105150

-3.35

98.8

5'TCTGCCTCAGCAACCAGAGA3'

3'TCCGAATCGCCGTCTTTC5'

SOX9

XM_001498424

-3.33

99.9

5' CTTTGGTTTGTGTTCGTGTTTTGT3'

3'AGAGAAAGAAAAAGGGAAAGGTAA GTTT5'

OPN

XM_001496152

-3.33

99.9

5'CGCAGATCTGAAGACCAGTATCCT3'

3'TGCTTTCCACAGGTGATGTGA5'

RUNX2

XM_001502519

-3.36

98.4

5'CTGGGCCATGTGTATGATTTGT3'

3'TTTTGACCTGATATAGAGTGCATGGT5'

OMD

XR_035840

-3.26

103.4

5'CAAATTCATCAACCCCTGAAA3'

3'CTTCATCTGGCTCTTGGTCA5'


Taylor et al. BMC Musculoskeletal Disorders 2009 10:27   doi:10.1186/1471-2474-10-27

Open Data