Table 1

Reference gene primer sequences used for qPCR

Gene

SCS

Efficiency (%)

Sequence


GapDH

AF157626

-3.32

100.2

5'GCATCGTGGAGGGACTCA3'

3'GCCACATCTTCCCAGAGG5'

18S

AJ311673

-3.24

103.3

5'GGCGTCCCCCAACTTCTTA3'

3'GGGCATCACAGACCTGTTATTG5'

ACTB

AF035774

-3.33

99.9

(Bogaerts et al., 2006)

5'CCAGCACGATGAAGATCAAG3'

3'GTGGACAATGAGGCCAGAAT5'

SDHA

DQ402987

-3.29

101.5

5'ACAGAGGAATGGTCTGGAATACTGA3'

3' GTGAGCACCACGTGACTCCTT5'


SCS = Standard Curve Slope

Taylor et al. BMC Musculoskeletal Disorders 2009 10:27   doi:10.1186/1471-2474-10-27

Open Data