Table 1

Primers used for identification of enterovirus

Primer

Sequence (5'-3')

Orientation (position)*

Amplification of


EVP-2 [22]

CGGAACCGACTACTTTGGGTGACCGT

Sense (538–563)

HEV71 VP4 gene.

VP2-REV [24]

TTCCAATACCACCCCTTGGATGA

Antisense (1195-1173)

HEV71 VP4 gene.

159 [19]

ACYATGAAAYTGTGCAAGG

Sense (2385–2403)

HEV71 VP1 gene.

162 [19]

CCRGTAGGKGTRCACGCRAC

Antisense (2869-2850)

HEV71 VP1 gene.

161 [19]

CTGGGACATAGAYATAACWGG

Sense (2766–2785)

HEV71 VP1 gene.

NP1A [19]

GCICCICAYTGITGICCRAA

Antisense (3355-3336)

HEV71 VP1 gene.

MAS01S [20]

ATAATAGCAYTRGCGGCAGCCCA

Sense (2355–2377)

partial VP1 gene.

MAS02A [20]

AGAGGGAGRTCTATCTCYCC

Antisense (2731-2712)

partial VP1 gene.

MD91 [18]

CCTCCGGCCCCTGAATGCGGCTAAT

Sense (450–474)

partial 5UTR.

MD90 [18]

ATTGTCACCATAAGCAGCCA

Antisense (603-584)

partial 5UTR.


*Position relative to the genome of HEV71 strain 7423-MS-87 (GenBank accession number U22522)

Podin et al. BMC Public Health 2006 6:180   doi:10.1186/1471-2458-6-180

Open Data