Figure 1.

Construction of shRNA vector targeting human XTLY-I gene. A: The construct of Pgenesil-1 vector: This RNAi vector was a self-inactivating retroviral expression vector designed to express a small interfering dsRNA (siRNA) using the human U6 promoter. Neomycin-resistant selecting marker was used to select for stable clones. GFP was used to determine the successful transfection. B: shRNA-WJ4: AGCTTGTCGACAAAAAACAGGCAGCCCATCAAACCTCGTCTTGAAA G GTTTGATGGGCTGCCTGCG.