Abstract
Background
Leptin, a 16 kDa polypeptide hormone, implicated in various physiological processes, exerts its action through the leptin receptor, a member of the class I cytokine receptor family. Both leptin and leptin receptor have recently been implicated in processes leading to breast cancer initiation and progression in animal models and humans. An A to G transition mutation in codon 223 in exon 6 of the leptin receptor gene, resulting in glutamine to arginine substitution (Gln223Arg), lies within the first of two putative leptin-binding regions and may be associated with impaired signaling capacity of the leptin receptor. This study was designed to assess the role of this polymorphism in breast cancer susceptibility in Nigerian women.
Methods
We utilized a polymerase chain reaction (PCR)-based restriction fragment length polymorphism (RFLP) assay to evaluate the association between the Gln223Arg polymorphism of the leptin receptor gene and breast risk in Nigeria in a case control study involving 209 women with breast cancer and 209 controls without the disease. Study participants were recruited from surgical outpatient clinics and surgical wards of four University Teaching Hospitals located in Midwestern and southeastern Nigeria between September 2002 and April 2004.
Results
Premenopausal women carrying at least one LEPR 223Arg allele were at a modestly increased risk of breast cancer after adjusting for confounders (OR = 1.8, 95% confidence interval [CI] 1.0–3.2, p = 0.07). There was no association with postmenopausal breast cancer risk (OR = 0.9, 95% CI 0.4–1.8, p = 0.68).
Conclusion
Our results suggest that the LEPR Gln223Arg polymorphism in the extracellular domain of the LEPR receptor gene is associated with a modestly increased risk of premenopausal breast cancer in Nigerian women.
Background
Leptin, a 16 kDa polypeptide hormone produced predominantly by white adipose tissue [1], plays an important role in body weight homeostasis through effects on food intake and energy expenditure [2,3]. In addition to the regulation of body weight, leptin also influences hematopoiesis, reproduction, angiogenesis, and immune processes [4-6]. Leptin exerts its physiological action through the leptin receptor (LEPR), a member of the class I cytokine receptor family. The leptin receptor is a single transmembrane protein and has several alternatively spliced isoforms (one long isoform and several short isoforms) that are distributed in many tissues [7,8]. LEPRs have been detected in human breast epithelial cell lines, breast cancer-derived cell lines (T47-D and MCF-7) and in human breast cancer tissue specimens [9-11]. In addition, leptin consistently stimulates the proliferation of benign and malignant epithelial breast cells in vitro as measured by DNA synthesis, cellular density and up-regulation of downstream regulators of cellular proliferation [9-12].
Several single nucleotide polymorphisms (SNPs) in the LEPR gene have been described. Chung et al. [13] identified three allelic variants associated with amino acid changes (Lys109Arg, Gln223Arg, and Lys656Asn), three silent mutations (nt 1222 T→C, nt 3217 A→G, and nt 3250 G→A), and four intronic sequence variants. All three amino acids (Lys109Arg, Gln223Arg, and Lys656Asn) are conserved among rat, mouse, and human species [14,15], but only Gln223Arg and Lys656Asn result in changes in charge (neutral to positive and positive to neutral, respectively) and are, therefore, most likely to have functional consequences. The Gln223Arg polymorphism is within the region encoding the extracellular domain of the leptin receptor and therefore, the amino acid change affects all forms of the receptor. It has been shown that the LEPR Gln223Arg polymorphism is associated with variation in ligand binding; higher levels of ligand binding activity has been demonstrated in individuals homozygous for the G (LEPR Arg223Arg) allele than for carriers of the A (LEPR 223Gln) allele [16].
Despite these premises, very few studies have considered the role of serum leptin levels and polymorphisms in leptin and LEPR genes in breast cancer risk [17-23]. Four studies [17-20] on plasma leptin levels and breast cancer risk have shown conflicting results; one in the Italian population [17] and another among the Chinese [18] reported significant increased risk of breast cancer with higher serum leptin levels while two other studies [19,20] in the Greek and U.S. populations, respectively, found no associations. Of two studies that evaluated relationship between LEPR Gln223Arg polymorphism and serum leptin levels, one study among college students in Greece [21] reported significantly higher leptin levels in heterozygote (LEPR Gln223Arg) and homozygote (LEPR Arg223Arg) carriers of the G allele; the second study by Quinton et al. [16] among postmenopausal British women reported lower leptin levels among carriers of the G allele. Only two studies [22,23] have examined allelic variants of the LEPR genes in breast cancer susceptibility; one [22] reported positive association among Tunisian women while the other [23] found no association between these variants and breast cancer risk in Korean women. We are unaware of any study of this susceptibility marker and breast cancer risk in black populations. Although, several polymorphisms have been described in the LEPR gene, we have chosen in this exploratory study to evaluate the role of the LEPR Gln223Arg polymorphism in breast cancer susceptibility in Nigerian women since it is the most studied functional LEPR gene polymorphism in human subjects.
Methods
Subjects
The recruitment of participants for this study from four University Teaching Hospitals located in southern Nigeria (University of Benin Teaching Hospital, Benin City; Nnamdi Azikiwe University Teaching Hospital, Nnewi; University of Nigeria Teaching Hospital, Enugu; and University of Port Harcourt Teaching Hospital, Port Harcourt between September 2002 and April 2004) has been described elsewhere [24,25]. Briefly, 209 women with confirmed breast cancer and 209 age-matched control subjects without the disease or any other malignancy were recruited during surgical outpatient visits or hospital admissions. Control subjects were being treated in the same hospitals for non-malignant diseases including unintentional injuries, acute inflammatory diseases such as chronic duodenal ulcer, appendicitis, pelvic inflammatory disease and urolithiasis. The study protocol was approved by the Institutional Review Board of University of Pittsburgh and the Ethics and Research Committees of the Nigerian institutions prior to commencement. Women with suspected breast cancer without histological confirmation and those that refused sample donation were excluded from the study.
Study participants signed informed consent after detailed explanation of the purpose, risks and benefits, confidentiality and rights of participants prior to recruitment. Data in respect of reproductive history, demographic characteristics, occupational exposure to pesticides and fertilizers and lifestyle choices including alcohol consumption and cigarette smoking were obtained using interviewer-administered questionnaires. Anthropometric measurements including height, weight, waist and hip circumferences were taken at the end of the interview.
Sample Donation and Preparation
Ten milliliters (ml) blood sample was collected into one 10 ml K3-EDTA vacutainer tube from each of the study participants at the end of the interview. The buffy coat was prepared by centrifuging whole blood 2500 × g for 10 min at room temperature. All the samples were stored at -20°C in the Nigerian coordinating center at the University of Benin Teaching Hospital and later shipped to University of Pittsburgh in dry ice. Samples were stored at -80°C at the University of Pittsburgh until DNA extraction. DNA extraction from buffy coats (and clots for subjects with no buffy coats) was carried out using QIAamp DNA Mini Kits (for buffy coats) and QIAamp DNA Midi Kits (for blood clots) protocols (QIAGEN Inc, Valencia, CA). The extracted DNA was stored at 4°C until used for polymerase chain reaction (PCR) and restriction fragment length (RFLP) analysis.
PCR and RFLP analysis
Genomic DNA from the cases and control subjects were analyzed for the presence of the A to G mutation at codon 223 of the LEPR gene by a PCR-based restriction fragment length polymorphism (RFLP) assay. PCR amplification of an 80 bp fragment of the LEPR gene, including part of exon 6 that contains the polymorphism was carried out using forward primer: AAACTCAACGACACTCTCCTT and reverse primer: TGAACTGACATTAGAGGTGAC. A 50 μl PCR reaction mixture containing 2 μl of genomic DNA, 5 μl of deoxynucleotide triphosphates, 3 μl each of forward and reverse primers, 5 μl of 10× buffer, 1.5 μl of MgCl2 and 0.5 μl of Taq polymerase was placed in a thermocycler. After denaturing for 5 min at 95°C, the DNA was amplified for 35 cycles at 95°C for 30 sec, 59°C for 45 sec, and 72°C for 60 sec, followed by a 5 min extension at 72°C. A positive control containing genomic DNA and a negative control containing everything except DNA were included in the PCR experiment. Five μl of each PCR product, including the controls, were verified on a 3% agarose gel to ensure that the expected 80 bp product was generated.
Restriction digest for the DNA fragment was carried out using Msp 1 restriction enzyme. Fifteen μl of the PCR product was digested for 16 h overnight at 37°C with 10 units of Msp 1 (New England Biolabs). The product of the restriction digest was mixed with 10 μl of loading dye and verified on a 3% agarose gel (with Ethidium bromide) electrophoresis in a 1× Tris-Borate-EDTA buffer at 200 V for 60 min. The presence of an A at position 668 (LEPR codon 223) generated a unique 80 bp fragment, while the 80 bp fragment was divided into unique 58 bp and 22 bp fragments when position 668 contains a G. The gels were visualized by UV light and the RFLP gel electrophoresis products were read by two independent persons who were unaware of the identities of samples as either cases or controls. DNA extraction and RFLP assays employing Msp 1 restriction enzyme were successful in 209 cases and 209 control subjects; therefore the analysis is restricted to this sample of women.
Statistical Analyses
Statistical analysis was carried out using the Statistical Analysis System (SAS) software (Version 8.0). Although the original data was matched by age, the analysis of the genetic data was conducted on the unmatched sample, since DNA was not available on all the study participants. Therefore an unmatched analysis was conducted and an adjustment for age was performed. Unconditional logistic regression was used to assess the association between the LEPR Gln223Arg genotypes and breast cancer risk in the whole sample. Stratified analyses according to menopausal status were then carried out. Relevant risk factors that were identified as significant predictors of breast cancer risk were controlled for in the multivariate logistic regression models.
Results
Demographic Characteristics
A total of 418 female participants were recruited from the surgical outpatient clinics and surgical wards of the four University Teaching Hospitals in southern Nigeria. Two hundred and nine of them were being managed for various stages of breast cancer while the remaining 209 women, being treated for various non-malignant diseases in the same institutions served as control subjects. The ages of the cases and control subjects were similar with mean ages of 46.1 ± 12.63 years and 47.1 ± 13.50 years for cases and controls, respectively. Details on the associations between anthropometric, demographic and reproductive variables are reported elsewhere [26,27].
Allele and Genotype Frequencies in All women
Our results indicate that the LEPR Gln223Arg variant is highly polymorphic in the Nigerian population. The distribution of the LEPR Gln223Arg alleles and genotypes are shown in Table 1. When all study participants were considered together, the distribution of the LEPR 223Gln allele was similar in cases and controls with allele frequencies of 0.49 and 0.51, respectively while the frequency of the LEPR 223Arg allele was 0.51 and 0.49, respectively. The homozygous LEPR Gln223Gln genotype was slightly less common in the cases compared to the controls with genotype frequencies of 0.22 and 0.27, respectively while the heterozygous LEPR Gln223Arg genotype was equally distributed among cases and controls with frequency of 0.51 in both cases and control subjects. The homozygous Arg223Arg genotype was slightly more common in the cases compared to the controls with frequencies of 0.27 and 0.22, respectively. The distribution of the LEPR 223Gln and 223Arg alleles among the controls were in Hardy-Weinberg equilibrium overall and in both premenopausal and postmenopausal women.
Table 1. Distribution of Leptin receptor (LEPR) alleles and genotypes in relation to breast cancer risk (unconditional logistic regression)
Premenopausal Women
The DNA extraction and RFLP Msp 1 assays were successful in 114 premenopausal breast cancer cases and 121 control subjects. The LEPR 223Gln allele was less frequent in premenopausal breast cancer cases compared to those without breast cancer with allele frequencies of 0.46 and 0.54, respectively. The wild-type LEPR Gln223Gln genotype was less frequent in the women with breast cancer compared to those without the disease, with genotype frequencies of 0.20 and 0.31, respectively. (Table 1).
Postmenopausal Women
There was no apparent difference in the distribution of the LEPR 223Gln and LEPR 223Arg alleles in postmenopausal women with breast cancer compared to the control subjects. The LEPR Gln223Gln genotype frequencies were 0.24 in cases and 0.21 in the controls as shown in Table 1.
LEPR Gln223Arg Genotypes and Breast Cancer Risk in All Women
Compared to women with the LEPR Gln223Gln genotype, those harboring the heterozygous LEPR Gln223Arg genotype (OR = 1.2, 95% CI 0.8–2.0, p = 0.42) and the homozygous mutant LEPR Arg223Arg genotype (OR = 1.5, 95% CI 0.8–2.6, p = 0.16) had no significant increased risk of breast cancer.
The presence of at least one LEPR 223Arg allele (LEPR Gln223Arg + LEPR Arg223Arg genotypes) was not associated a significant risk of breast cancer in these women (OR = 1.3, 95% CI 0.8–2.0, p = 0.26). Adjusting for waist/hip ratio, a surrogate measure of obesity did not significantly alter the risk profile in these women as shown in Table 1.
Premenopausal Women
Among premenopausal women, there was a marginally increased risk of breast cancer with the LEPR 223Arg allele (LEPR Gln223Arg + LEPR Arg223Arg): OR = 1.8, 95% CI 1.0–3.3, p = 0.05 (Table 1). The heterozygous LEPR Gln223Arg genotype was associated with a modestly increased risk of breast cancer (OR = 1.8, 95% CI 1.0–3.5, p = 0.06). The homozygous LEPR Arg223Arg genotype was also associated with some modest increase in breast cancer risk (OR = 1.8, 95% CI 0.9–3.6, p = 0.12). These risk profiles were unaltered when the analysis was adjusted for waist/hip ratio and age (LEPR Gln223Arg + LEPR Arg223Arg OR = 1.8, 95% CI 1–3.2, p = 0.07; LEPR Gln223Arg genotype OR = 1.8, 95% CI 0.9–3.3, p = 0.07 and LEPR Arg223Arg genotype OR = 1.8, 95% CI 0.8–3.7, p = 0.14).
Postmenopausal Women
Among postmenopausal women there was no significant relationship between the LEPR Gln223Arg polymorphism and breast cancer risk (Table 1). Adjusting for waist/hip ratio did not significantly alter the risk profiles.
Discussion
The results of our study showed that the LEPR Gln223Arg variant is highly polymorphic in the Nigerian population. The LEPR 223Arg allele frequency of 0.49 in our study participants is higher than figures reported in Caucasians (0.45), Pima Indians (0.32), Arabs (0.34) but much lower than figures in Asian populations (0.85) [28]. Although a study of mixed U.S. population by Chung et al. [13] reported little difference in LEPR 223Arg allele frequency by racial groups, the study recruited only 26 blacks and racial admixture in the U.S. population may partly account for their finding. The International Hapmap Project reported LEPR 223Arg allele frequencies of 0.61 among Yorubas in Ibadan, Nigeria and 0.53 in African Americans. [29]
The evaluation of the relationship of the LEPR Gln223Arg polymorphism and breast cancer risk showed that premenopausal women carrying at least one LEPR 223Arg allele were at a modestly increased risk of breast cancer (OR = 1.8, 95% CI 1.0–3.3, p = 0.05); the risk was unaltered after adjusting for waist/hip ratio and age (OR = 1.8, 95% CI 1.0–3.2, p = 0.07). There was no association between the LEPR Gln223Arg polymorphism and breast cancer risk in postmenopausal women. Two studies [22,23] evaluated the LEPR Gln223Arg polymorphism in relation to breast cancer risk; one [22] in the Tunisia population reported significantly increased risk in both premenopausal and postmenopausal women in a dose dependent manner (OR = 1.68, 95% CI 1.12–2.50 and OR = 2.26, 95% CI 1.31–3.90 for the LEPR Gln223Arg and Arg223Arg genotypes, respectively). In addition, the authors noted that the presence of the LEPR 223Arg allele was associated with poorer overall survival. The second study by Woo et al. [23] found no association between the polymorphism and breast cancer risk in both premenopausal and postmenopausal Korean women (OR = 0.54, 95% CI 0.19–1.81). The authors noted the rarity of the LEPR 223Gln allele in the Korean population (allele frequency, 0.09) and the small sample size of their study (45 breast cancer cases and 45 control subjects). Some investigators [16,18,21] have examined the relationship between variants of the LEPR Gln223Arg polymorphism and serum levels of leptin since there is some evidence associating serum leptin levels with breast cancer risk [17,18]. In a study involving 118 college students in Greece (62 females and 56 males), Yiannkouris et al. [21] reported significantly higher serum leptin levels in individuals who were homozygous LEPR Arg223Arg compared with those harboring at least one LEPR 223Gln allele. Another study of 220 postmenopausal women in the U.K. found significant association between serum leptin levels and the LEPR genotype [16].
Although the actual mechanisms of leptin's role in breast cancer risk are not completely known, several lines of evidence provide support for leptin's broader physiological role, including the regulation of several neuroendocrine axes, some of which play a significant role in the pathogenesis of breast cancer. Leptin treatment corrects the hypogonadism of leptin-deficient ob/ob mice [30,31] and starved normal mice [32], accelerates the onset of puberty in rodents and increasing leptin levels may signal the onset of puberty in boys and girls [33,34]. In addition, leptin's pulsatile secretion is synchronized with the pulsatility of luteinizing hormone and estradiol in normal women [35]. Leptin has been shown to regulate GH secretion [36] and serum leptin levels have been associated with circulating IGF-1 and IGFBP-3 levels in normal and GH-deficient humans [34,37]. In addition, circulating leptin levels have been associated with certain life-style factors, such as smoking and alcohol intake [34]. Interestingly, the above endocrine axes and life-style factors have also been implicated in the pathogenesis of breast cancer via leptin's interaction with IGF-I and IGFBP-3 [38,39].
Tumor markers that are elevated in breast cancer can upregulate leptin production. These factors, including TNF-α, IL-1α, IL-1β, VEGF, and fibroblast growth factor 2 (FGF-2), raise leptin levels and promote tumor growth and differentiation [40,41]. In experimental studies, leptin consistently stimulated human breast epithelial cell lines and breast cancer-derived cell lines resulting in increased DNA synthesis evaluated by thymidine incorporation test and increased cellular growth estimated by cellular density [9-12]. Several down-stream effects of leptin signaling leading to cellular proliferation were also observed including increased expression of phosphorylated signal transducers (STAT3), extracellular signal-regulated kinase (ERK), mitogen-activated protein kinases (MAPK) and transcript activator protein (AP-1), and also increased expression of cyclin dependent kinase-2 and cyclin D1, two cell-cycle regulating proteins [9,10]. It has been suggested that the single amino acid change in the LEPR gene (LEPR Gln223Arg), a glutamine for an arginine with a change from neutral to positive, could affect the functionality of the receptor and alter its signaling capacity [13,42,43]. The finding of higher leptin binding activity (LBA) levels in homozygous carriers of the G allele (LEPR Arg223Arg) and higher levels of leptin in the LEPR Arg223Arg homozygotes and our finding of increased premenopausal breast cancer risk in women carrying the LEPR 223Arg allele provides supportive evidence for this proposition. It is possible that the leptin polymorphism is in linkage disequilibrium with other genes that play a role in breast cancer risk.
An important observation is the paucity of epidemiological literature on the role of polymorphisms in the leptin receptor (LEPR) gene in breast cancer susceptibility in most populations and its complete absence in sub-Saharan African populations. Much has been said about the mechanisms of leptin-induced carcinogenesis in animal models and correlation of serum leptin levels with breast cancer risk [17-20]. The effect of genotypes such as LEPR Gln223Arg polymorphism on breast cancer may vary from one population to the other as a result of marked differences in the distribution of the alleles in different populations. The finding of interaction between LEPR Gln223Arg genotypes and menopausal status and obesity may also partly explain the differences in reports from various populations. In the developed countries with a much higher percentage of postmenopausal breast cancer and a higher proportion of obese women, LEPR Gln223Arg polymorphism may be expected to have more impact on risk of the disease compared to the Nigerian population with a lower prevalence of obesity. Some of the limitations of this study include use of both incident and prevalent cases of breast cancer. Given the report of poorer prognosis associated with the LEPR 223Arg allele in some studies, it is possible that some patients harboring this allele might have died earlier leaving us with more patients with the LEPR 223Gln allele. However, such a bias if prevent would result in underestimation of the risk associated with the putative high risk LEPR 223Arg allele. There is currently no breast cancer screening program in Nigeria; therefore patients with early pre-clinical disease may have been missed in our study. Use of hospital controls is necessitated by the limited research infrastructure such as poor communication facilities and lack of population-based cancer registries in developing countries such as Nigeria.
Another issue of concern is the sample size of this study. In fact, we estimate that with an allele frequency of .49 in all women combined, a sample size of 139 cases and controls provides a power of 80% to detect an odds ratio (OR) of 2.0. There were a total of 209 cases and 209 controls in our study population indicating that this sample size has adequate statistical power to detect an OR of 2.0. However, when we stratify by menopausal status, the number of cases and controls become much lower, thus decreasing the statistical power of the study. For example, a sample size of 137 premenopausal cases and 137 premenopausal controls would be adequate to detect an odds ratio of 2.0 while there were 114 premenopausal cases and 121 premenopausal controls in our study. It is possible that variations in LEPR polymorphisms and other low penetrance genes may contribute to the marked worldwide variation in breast cancer incidence, with the highest age-standardized incidence rate (ASR) in North America (ASR, 99.4 per 100,000) and the lowest age-standardized incidence rates in sub-Saharan Africa (ASR, 27.8 per 100,000 in West Africa, 19.5 per 100,000 in East Africa and 16.5 per 100,000 in Central Africa) [44].
Conclusion
In conclusion, this study has demonstrated a modestly increased risk of premenopausal breast cancer in women harboring the LEPR 223Arg allele of the LEPR Gln223Arg polymorphism of the leptin receptor gene. To the best of our knowledge, ours is the first study to provide information on the role of LEPR Gln223Arg polymorphism in breast cancer risk in sub-Saharan African women, a population characterized by paucity of epidemiological literature on the determinants of breast cancer and other malignancies.
Abbreviations
LEPR: Leptin receptor; DNA: Deoxyribonucleic acid; PCR: Polymerase chain reaction; SNP: Single Nucleotide Polymorphism; RFLP: Restriction fragment length polymorphism; STAT3: Signal transducers of activation of transcription; ERK: Extracellular signal-regulated kinase; MAPK: Mitogen-activated protein kinase; SAS: Statistical analysis systems
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
MNO, CHB, ET, SJG, REF, LHK, participated in conceptualization, design of the study and preparation of manuscript. MNO, ERE, SNA, and EEU recruited study participants from Nigeria and organized the transfer of biological samples to the University of Pittsburgh. MNO, CHB, ET, SJG and JMZ carried out the genetic analysis.
Acknowledgements
This study was supported by a post-doctoral grant awarded to Michael N. Okobia by the US Army Medical and Materiel Command's Breast Cancer Research Program (Award Number: DAMD17-02-1-0551). We are grateful to the staff of the Departments of Surgery of the Nigerian Study Sites including University of Benin Teaching Hospital, Benin City; Nnamdi Azikiwe University Teaching Hospital, Nnewi; University of Nigeria Teaching Hospital, Enugu; and the University of Port Harcourt Teaching Hospital, Port Harcourt, for all their assistance during the recruitment of study participants. Special thanks to the staff of the Department of Epidemiology, University of Pittsburgh for their invaluable assistance throughout the conduct of this study.
References
-
Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM: Positional cloning of the mouse obese gene and its human homologue.
Nature 1994, 372:425-432. PubMed Abstract | Publisher Full Text
-
Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P: Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks.
Science 1995, 269:546-549. PubMed Abstract | Publisher Full Text
-
Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, et al.: Weight-reducing effects of the plasma protein encoded by the obese gene.
Science 1995, 269:543-546. PubMed Abstract | Publisher Full Text
-
Bennett BD, Solar GP, Yuan JQ, Mathias J, Thomas GR, Matthews W: A role for leptin and its cognate receptor in hematopoiesis.
Curr Biol 1996, 6:1170-1180. PubMed Abstract | Publisher Full Text
-
Bouloumie A, Drexler HC, Lafontan M, Busse R: Leptin, the product of Ob gene, promotes angiogenesis.
Circ Res 1998, 83:1059-1066. PubMed Abstract | Publisher Full Text
-
Loffreda S, Yang SQ, Lin HZ, Karp CL, Brengman ML, Wang DJ, et al.: Leptin regulates proinflammatory immune responses.
FASEB J 1998, 12:57-65. PubMed Abstract | Publisher Full Text
-
Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh JG, Lee JI, et al.: Abnormal splicing of the leptin receptor in diabetic mice.
Nature 1996, 379:632-635. PubMed Abstract | Publisher Full Text
-
Tartaglia LA: The leptin receptor.
J Biol Chem 1997, 272:6093-6096. PubMed Abstract | Publisher Full Text
-
Hu X, Juneja SC, Maihle NJ, Cleary MP: Leptin – a growth factor in normal and malignant breast cells and for normal mammary gland development.
J Natl Cancer Inst 2002, 94:1704-1711. PubMed Abstract | Publisher Full Text
-
Dieudonne MN, Machinal-Quelin F, Serazin-Leroy V, Leneveu MC, Pecquery R, Giudicelli Y: Leptin mediates a proliferative response in human MCF7 breast cancer cells.
Biochem Biophys Res Commun 2002, 293:622-628. PubMed Abstract | Publisher Full Text
-
Laud K, Gourdou I, Pessemesse L, Peyrat JP, Djiane J: Identification of leptin receptors in human breast cancer: functional activity in the T47-D breast cancer cell line.
Mol Cell Endocrinol 2002, 188:219-226. PubMed Abstract | Publisher Full Text
-
Okumura M, Yamamoto M, Sakuma H, Kojima T, Maruyama T, Jamali M, et al.: Leptin and high glucose stimulate cell proliferation in MCF-7 human breast cancer cells: reciprocal involvement of PKC-alpha and PPAR expression.
Biochim Biophys Acta 2002, 1592:107-116. PubMed Abstract | Publisher Full Text
-
Chung WK, Power-Kehoe L, Chua M, Chu F, Aronne L, Huma Z, et al.: Exonic and intronic sequence variation in the human leptin receptor gene (LEPR).
Diabetes 1997, 46:1509-1511. PubMed Abstract
-
Tartaglia LA, Dembski M, Weng X, Deng N, Culpepper J, Devos R, et al.: Identification and expression cloning of a leptin receptor, OB-R.
Cell 1995, 83:1263-1271. PubMed Abstract | Publisher Full Text
-
Phillips MS, Liu Q, Hammond HA, Dugan V, Hey PJ, Caskey CJ, et al.: Leptin receptor missense mutation in the fatty Zucker rat.
Nat Genet 1996, 13:18-19. PubMed Abstract | Publisher Full Text
-
Quinton ND, Lee AJ, Ross RJ, Eastell R, Blakemore AI: A single nucleotide polymorphism (SNP) in the leptin receptor is associated with BMI, fat mass and leptin levels in postmenopausal Caucasian women.
Hum Genet 2001, 108:233-236. PubMed Abstract | Publisher Full Text
-
Tessitore L, Vizio B, Pesola D, Cecchini F, Mussa A, Argiles JM, et al.: Adipocyte expression and circulating levels of leptin increase in both gynaecological and breast cancer patients.
Int J Oncol 2004, 24:1529-1535. PubMed Abstract
-
Han C, Zhang HT, Du L, Liu X, Jing J, Zhao X, et al.: Serum levels of leptin, insulin, and lipids in relation to breast cancer in china.
Endocrine 2005, 26:19-24. PubMed Abstract | Publisher Full Text
-
Petridou E, Papadiamantis Y, Markopoulos C, Spanos E, Dessypris N, Trichopoulos D: Leptin and insulin growth factor I in relation to breast cancer (Greece).
Cancer Causes Control 2000, 11:383-388. PubMed Abstract | Publisher Full Text
-
Mantzoros CS, Bolhke K, Moschos S, Cramer DW: Leptin in relation to carcinoma in situ of the breast: a study of pre-menopausal cases and controls.
Int J Cancer 1999, 80:523-526. PubMed Abstract | Publisher Full Text
-
Yiannakouris N, Yannakoulia M, Melistas L, Chan JL, Klimis-Zacas D, Mantzoros CS: The Q223R polymorphism of the leptin receptor gene is significantly associated with obesity and predicts a small percentage of body weight and body composition variability.
J Clin Endocrinol Metab 2001, 86:4434-4439. PubMed Abstract | Publisher Full Text
-
Snoussi K, Strosberg AD, Bouaouina N, Ben Ahmed S, Helal AN, Chouchane L: Leptin and leptin receptor polymorphisms are associated with increased risk and poor prognosis of breast carcinoma.
BMC Cancer 2006, 6:38. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
-
Woo HY, Park H, Ki CS, Park YL, Bae WG: Relationships among serum leptin, leptin receptor gene polymorphisms, and breast cancer in Korea.
Cancer Lett 2006, 237:137-142. PubMed Abstract | Publisher Full Text
-
Okobia M, Bunker C, Zmuda J, Kammerer C, Vogel V, Uche E, et al.: Cytochrome P4501A1 genetic polymorphisms and breast cancer risk in Nigerian women.
Breast Cancer Res Treat 2005, 94:285-293. PubMed Abstract | Publisher Full Text
-
Okobia MN, Bunker CH, Zmuda JM, Ezeome ER, Anyanwu SN, Uche EE, et al.: Simple tandem repeat (TTTA)n polymorphism in CYP19 (aromatase) gene and breast cancer risk in Nigerian women.
J Carcinog 2006, 5:12. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
-
Okobia M, Bunker C, Zmuda J, Kammerer C, Vogel V, Uche E, et al.: Case-control study of risk factors for breast cancer in Nigerian women.
Int J Cancer 2006, 119:2179-2185. PubMed Abstract | Publisher Full Text
-
Okobia MN, Bunker CH, Zmuda JM, Osime U, Ezeome ER, Anyanwu SN, et al.: Anthropometry and breast cancer risk in nigerian women.
Breast J 2006, 12:462-466. PubMed Abstract | Publisher Full Text
-
Paracchini V, Pedotti P, Taioli E: Genetics of leptin and obesity: a HuGE review.
Am J Epidemiol 2005, 162:101-114. PubMed Abstract | Publisher Full Text
-
International HapMap Project [http://www.hapmap.org/cgi-perl/snp_details?name=rs1137101&source=hapmap_B36] webcite
-
Chehab FF, Lim ME, Lu R: Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin.
Nat Genet 1996, 12:318-320. PubMed Abstract | Publisher Full Text
-
Barash IA, Cheung CC, Weigle DS, Ren H, Kabigting EB, Kuijper JL, et al.: Leptin is a metabolic signal to the reproductive system.
Endocrinology 1996, 137:3144-3147. PubMed Abstract | Publisher Full Text
-
Ahima RS, Prabakaran D, Mantzoros C, Qu D, Lowell B, Maratos-Flier E, et al.: Role of leptin in the neuroendocrine response to fasting.
Nature 1996, 382:250-252. PubMed Abstract | Publisher Full Text
-
Mantzoros CS, Flier JS, Rogol AD: A longitudinal assessment of hormonal and physical alterations during normal puberty in boys. V. Rising leptin levels may signal the onset of puberty.
J Clin Endocrinol Metab 1997, 82:1066-1070. PubMed Abstract | Publisher Full Text
-
Mantzoros CS, Moschos SJ: Leptin: in search of role(s) in human physiology and pathophysiology.
Clin Endocrinol (Oxf) 1998, 49:551-567. PubMed Abstract | Publisher Full Text
-
Licinio J, Negrao AB, Mantzoros C, Kaklamani V, Wong ML, Bongiorno PB, et al.: Synchronicity of frequently sampled, 24-h concentrations of circulating leptin, luteinizing hormone, and estradiol in healthy women.
Proc Natl Acad Sci USA 1998, 95:2541-2546. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Carro E, Senaris R, Considine RV, Casanueva FF, Dieguez C: Regulation of in vivo growth hormone secretion by leptin.
Endocrinology 1997, 138:2203-2206. PubMed Abstract | Publisher Full Text
-
Paolisso G, Ammendola S, Del Buono A, Gambardella A, Riondino M, Tagliamonte MR, et al.: Serum levels of insulin-like growth factor-I (IGF-I) and IGF-binding protein-3 in healthy centenarians: relationship with plasma leptin and lipid concentrations, insulin action, and cognitive function.
J Clin Endocrinol Metab 1997, 82:2204-2209. PubMed Abstract | Publisher Full Text
-
Bruning PF, Van Doorn J, Bonfrer JM, Van Noord PA, Korse CM, Linders TC, et al.: Insulin-like growth-factor-binding protein 3 is decreased in early-stage operable pre-menopausal breast cancer.
Int J Cancer 1995, 62:266-270. PubMed Abstract | Publisher Full Text
-
Bohlke K, Cramer DW, Trichopoulos D, Mantzoros CS: Insulin-like growth factor-I in relation to premenopausal ductal carcinoma in situ of the breast.
Epidemiology 1998, 9:570-573. PubMed Abstract | Publisher Full Text
-
Sierra-Honigmann MR, Nath AK, Murakami C, Garcia-Cardena G, Papapetropoulos A, Sessa WC, et al.: Biological action of leptin as an angiogenic factor.
Science 1998, 281:1683-1686. PubMed Abstract | Publisher Full Text
-
Ribatti D, Nico B, Belloni AS, Vacca A, Roncali L, Nussdorfer GG: Angiogenic activity of leptin in the chick embryo chorioallantoic membrane is in part mediated by endogenous fibroblast growth factor-2.
Int J Mol Med 2001, 8:265-268. PubMed Abstract
-
Chagnon YC, Chung WK, Perusse L, Chagnon M, Leibel RL, Bouchard C: Linkages and associations between the leptin receptor (LEPR) gene and human body composition in the Quebec Family Study.
Int J Obes Relat Metab Disord 1999, 23:278-286. PubMed Abstract | Publisher Full Text
-
Chagnon YC, Wilmore JH, Borecki IB, Gagnon J, Perusse L, Chagnon M, et al.: Associations between the leptin receptor gene and adiposity in middle-aged Caucasian males from the HERITAGE family study.
J Clin Endocrinol Metab 2000, 85:29-34. PubMed Abstract | Publisher Full Text
-
Parkin DM, Bray F, Ferlay J, Pisani P: Global cancer statistics, 2002.
CA Cancer J Clin 2005, 55:74-108. PubMed Abstract | Publisher Full Text
Pre-publication history
The pre-publication history for this paper can be accessed here:




