|
siRNA's Employed in Knockdown Experiments. |
|||
| Gene |
Sense Strand |
Antisense Strand |
mRNA Target |
|
|
|||
| TFIIS #1 |
aatgctattcgcaagcagagt |
aaactctgcttgcgaatagca |
aaugcuauucgcaagcagagu |
| TFIIS #2 |
aacaggggatgactacattgc |
aagcaatgtagtcatcccctg |
aacaggggaugacuacauugc |
| TFIIS #3 |
aagagatgcggaaaaacttga |
aatcaagtttttccgcatctc |
aagagaugcggaaaaacuuga |
|
Sense and antisense template strands shown also contained a cctgtctc T7 promoter primer sequence on the 3' terminal. Once the individual template strands had been transcribed, they were hybridized to form the 21-nt double stranded short interfering RNA (siRNA). | |||
Hubbard et al. BMC Cancer 2008 8:133 doi:10.1186/1471-2407-8-133 |
|||