Table 1

Candidate single nucleotide polymorphisms (SNPs) and their respective probes and primers

Gene

Location

SNP ID

Forward primer

Reverse primer

FAM probe

TET probe


IL-1A

+4845 G>T

rs17561

TGCACTTGTGATCATGGTTTTAGA

TCCTCATAAAGTTGTATTTCACATTGC

CAAGCCTAGGTCATCACCTTTTAGCTTCC

AAGCCTAGGTCAGCACCTTTTAGCTTCC

IL-1B

-511 C>T

rs16944

TTGAGGGTGTGGGTCTCTACCT

AGGAGCCTGAACCCTGCATAC

TTCTCTGCCTCGGGAGCTCTCTGT

TTCTCTGCCTCAGGAGCTCTCTGTCA

IL-1B

+3954 C>T

rs1143634

GCCTGCCCTTCTGATTTTATACC

CATCGTGCACATAAGCCTCGTTA

TTCAGAACCTATCTTCTTTGACACATGGGA

CAGAACCTATCTTCTTCGACACATGGGA

IL-1RN

+2018 T>C

rs419598

GGGATGTTAACCAGAAGACCTTCTATCT

CAACCACTCACCTTCTAAATTGACATT

AACAACCAACTAGTTGCTGGATACTTGCAA

ACAACCAACTAGTTGCCGGATACTTGC

IL-4R

+1902 A>G

rs1801275

AGGCTTGAGAAGGCCTTGTAA

CCGAAATGTCCTCCAGCAT

CATGTACAAACTCCTGATAGCCACTGGTG

CATGTACAAACTCCCGATAGCCACTGG

IL-6

-174 G>C

rs1800795

GCTGATTGGAAACCTTATTAAGATTGT

AATGACGACCTAAGCTGCACTTT

ACGTCCTTTAGCATCGCAAGACACAAC

ACGTCCTTTAGCATGGCAAGACACAAC

IL-10

-1082 G>A

rs1800896

GATAGGAGGTCCCTTACTTTCCTCTTA

CACACACAAATCCAAGACAACACTAC

CTACTTCCCCCTCCCAAAGAAGCCT

CCTACTTCCCCTTCCCAAAGAAGCC


Note: All sequences are from 5' end to 3' end.

Balasubramanian et al. BMC Cancer 2006 6:188   doi:10.1186/1471-2407-6-188

Open Data