Table 1

Primers used in this study
Marker or gene       Primer (5-3)
BAT-25 FW -TCGCCTCCAAGAATGTAAGT
RV - TCTGCATTTTAACTATGGCTC
BAT-26 FW -TGACTACTTTTGACTTCAGCC
RV -AACCATTCAACATTTTTAACCC
D5S346 FW -ACTCACTCTAGTGATAAATCG
RV-AGCAGATAAGACAGTATTACTAGTT
BAT40 FW -GTAGAGCAAGACCACCTT
RV - AATAACTTCCTACACCACAAC
D2S123 FW -AATGGACAAAAACAGGATGC
RV -CCCTTTCTGACTTGGATACC
D11S912 FW -TACTGCTTTGGGTATGCATATG
RV -GCTTTTTGTCTAGCCATGATTG
D17S250 FW -GGAAGAATCAAATAGACAA
RV -GCTGGCCATATATATATTTAAACC
MGMT FW - CACCACACTGGACAGCCCTTT
RV - CGAACTTGCCCAGGAGCTTTATTT
MLH1 FW -AGAGTGGCTGGACAGAGGAA
RV -CCCTTCCTCATCAATTTCCA
RPS8 FW -AACAAGAAATACCGTGCCC
RV -GTACGAACCAGCTCGTTATTAG

Santos et al.

Santos et al. BMC Cancer 2013 13:79   doi:10.1186/1471-2407-13-79

Open Data