Table 1

Conditions of PCR reactions: oligonucleotide sequences, annealing temperatures, number of cycles of the reactions, and amplicon size
Genes Oligonucleotide sequences (5²-3²) ATa Cycles Amplicon size (bp) Reference
EGFR – exon 18 S F: CAAATGAGCTGGCAAGTGCCGTGTC 56°C 35 400 [22]
AS R: GAGTTTCCCAAACACTCAGTGAAAC
EGFR – exon 19 S F: GCAATATCAGCCTTAGGTGCGGCTC 58°C 35 372 [22]
AS R: CATAGAAAGTGAACATTTAGGATGTG
EGFR – exon 20 S F: CCATGAGTACGTATTTTGAAACTC 54°C 35 408 [22]
AS R: CATATCCCCATGGCAAACTCTTGC
EGFR – exon 21 S F: TAACGTTCGCCAGCCATAAGTCC 58°C 35 414 [22]
AS R: GCTGCGAGCTCACCCAGAATGTCTGG
β-actin S F: GATGAGATTGGCATGGCTTT 55°C 40 100 b
AS R: CACCTTCACCCGTTCCAGTTT
BRAF S F: CCTTTACTTACTACACCTCAGATA 54°C 40 189 b
AS R: AATCAGTGGAAAAATAGCCT
KRAS S F: TGATAGTGTATTAACCTTATGTGTGAC 54°C 40 170 b
AS R: TCTATTGTTGGATCATATTCGTC
GAPDH S F: CAACAGCCTCAAGATCATCAGCAA 60°C 40 123 b
AS R: AGTGATGGCATGGACTGTGGTCAT
EGFR S F: TAACAAGCTCACGCAGTTGG 60°C 40 178 b
AS R: GTTGAGGGCAATGAGGACAT
HER2 S F: CTCCTGTGTGGACCTGGATGAC 60°C 40 143 b
AS R: GCTGCCGTCGCTTGATGA

ª Annealing Temperature.

b Designed by authors.

Gonzaga et al.

Gonzaga et al. BMC Cancer 2012 12:569   doi:10.1186/1471-2407-12-569

Open Data