Table 1

Mature sequence, miRBase accession number and proposed clinical relevance for the six chosen miRNAs
miRNA name Mature miRNA sequence miRBase Accession number Proposed clinical relevance Comment Reference
hsa-miR-21 UAGCUUAUCAGACUGAUGUUGA MIMAT0000076 Overall survival High expression associated with poor OS [14]
hsa-miR-31 AGGCAAGAUGCUGGCAUAGCU MIMAT0000089 Tumor stage/ differentiation High expression associated with advanced tumor stage and poorly differentiated tumors [10]
hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU MIMAT0000092 Plasma marker Elevated levels as a possible diagnostic marker [13]
hsa-miR-101 UACAGUACUGUGAUAACUGAA MIMAT0000099 Increased invasiveness Decreased expression associated with invasiveness [8]
hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAG MIMAT0000103 Disease free and overall survival Down-regulation associated with poor disease free and overall survival. [7]
hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCU MIMAT0000437 Tumor size Low expression associated with large tumor size [9]

Schee et al.

Schee et al. BMC Cancer 2012 12:505   doi:10.1186/1471-2407-12-505

Open Data