Table 2

Primer sets used for quantitative RT-PCR analysis
Gene symbol alias forward primer(5'to 3') reverse primer(5'to 3')
BMP2 ACGAGGTCCTGAGCGAGTTC GAAGCTCTGAGGTGATAA
BMP4 CACCTCATCACACGACTAC GGCATGGTTGGTTGAGTTG
BMP6 GAGTCGTAATCGCTCTACCC GTGAACCAAGGTCTGCACAA
BMP7 CCAGAACCGCTCCAAGAC GTTGGTGGCGTTCATGTAG
TGFB1 CAGAAATACAGCAACAATTCC CTGAAGCAATAGTTGGTGTC
TGFB2 CCAAAGGGTACAATGCCAAC CAGATGCTTCTGGATTTATGGTATT
TGFB3 TAAGCGGAATGAGCAGAGG CCACGCCTTTGAATTTGATTT
ACVRL1 ALK1 CTGGACATCGGCAACAAC ACACCACCTTCTTCATGTC
ACVR1 ALK2 TGGCTTCCACGTCTACCA GCGAACACTACAGAGAGAA
BMPR1A ALK3 TATGGAGAAGTATGGATGGG GAACCTGTACCTTTAATGTCT
TGFBR1 ALK5 ATTACCAACTGCCTTATTATGA CATTACTCTCAAGGCTTCAC
BMPR2 TGGGATAGGTGAGAGTAGA GAGGGAGGAGTGGTAGTT
TGFBR2 ATGGAGGCCCAGAAAGATG GACTGCACCGTTGTTGTCAG

Boeuf et al.

Boeuf et al. BMC Cancer 2012 12:488   doi:10.1186/1471-2407-12-488

Open Data