Table 1

Primer sequences and PCR settings
Gene name Primer direction Sequences (5’-3’) Number of cycle Hybridization temperature
CD11a Forward GGGAATGACCTTGGCAACAGACCCCACAGAT 34 58
Reverse GGGTCTCCTGACTCTCCTTGGTCT
CD18 Forward CATCAGAGCTGCTGTAGAGC 31 60
Reverse GCTGACCTTGAACTTCGTGC
ICAM-1 Forward TGCAGCACCTCCTGTGACCA 25 60
Reverse CAGTTCCACCCGTTCTGGAG
E-Selectin Forward GGACTGCGTGGAGATCTACA 30 61
Reverse AGCCAGGGTCACACTTGCAA
N-Cadherin Forward GAAGGATGTGCATGAAGGAC 30 56
Reverse AGTTAAGGTTGGCTTCAGGC
GAPDH Forward GTCGTATTGGGCGCCTGGTCAC 15 60
Reverse AGGGGCCATCCACAGTCTTCTG

Ghislin et al.

Ghislin et al. BMC Cancer 2012 12:455   doi:10.1186/1471-2407-12-455

Open Data