Table 2

Primer sequences and annealing temperatures for copy number analysis by qPCR
Gene Primer sequence Tm,
PIK3CA F,5’- GCAAAGGTTGGTCGGTGAA -3’ 60
R,5’- GTGATCTTTGATGTTACTCTGATGCA -3’
KRAS F,5’- CACCCTAGACAAGCAGCCAATA -3’ 60
R,5’- AAGCCCTGCCGCAAAAA -3’
BRAF F,5’- CAAGTCACCACAAAAACCTATCGT -3’ 60
R,5- AACTGACTCACCACTGTCCTCTGTT -3’

The copy number changes in KRAS, BRAF and PIK3CA were evaluated by qPCR. DNA from the normal tissue from each sample was used as the control; each gene copy number in the normal tissue was set as 2, and a copy number more than 4 was considered to be a gain.

Suda et al.

Suda et al. BMC Cancer 2012 12:416   doi:10.1186/1471-2407-12-416

Open Data