Open Access Highly Accessed Research article

Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

Lili Jiang1, Jueheng Wu23, Yi Yang34, Liping Liu5, Libing Song5, Jun Li36 and Mengfeng Li237*

Author Affiliations

1 Department of Pathophysiology, Guangzhou Medical University, Guangzhou, Guangdong 510182 China

2 Department of Microbiology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, Guangdong 510080, China

3 Key Laboratory of Tropical Disease Control (Sun Yat-sen University), Chinese Ministry of Education, Guangzhou, Guangdong 510080, China

4 Department of Pharmacology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, Guangdong 510080, China

5 Department of Experimental Research, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong 510060, China

6 Department of Biochemistry, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, Guangdong 510080, China

7 Zhongshan School of Medicine, Sun Yat-sen University, 74 Zhongshan Road II, Guangzhou, Guangdong 510080, China

For all author emails, please log on.

BMC Cancer 2012, 12:406  doi:10.1186/1471-2407-12-406

Published: 11 September 2012

Additional files

Additional file 1:

Table S1. Clinicopathological characteristics of studied patients in gliomas [8].

Format: DOC Size: 37KB Download file

This file can be viewed with: Microsoft Word Viewer

Open Data

Additional file 2:

Figure S1. The expression level of MMP-2 and MMP-7. A, Real-time PCR quantification of MMP-2 and MMP-7 mRNA expression levels in Bmi-1-overexpressing and Bmi-1-silencing cells. MMP-2 and MMP-7 expression levels are presented as fold changes relative to vector-control cells and normalized to GAPDH. The primiers, MMP-2-up: CAGGGAATGAGTACTGGGTCTATT; MMP-2-dn: ACTCCAGTTAAAGGCAGCATCTAC;

    MMP-7-up
    :
AGCCAAACTCAAGGAGATGC;
    MMP-7-dn
    :
ACTCCACATCTGGGCTTCTG. B, ELISA assay of secreted MMP-2 and MMP-7 protein activity in cell supernatants. Error bars represent the mean ± SD of three independent experiments.

Format: TIFF Size: 220KB Download file

Open Data