Table 1

Primers for detection of HOXA10 mRNA and miR-135a by RT-PCR

Primers

Sequence


miR-135 RF

cgcgtctatggctttttattccta

anchor RT primer

cgactcgatccagtctcagggtccgaggtattcgatcgagtcgcactttttttttttt

Universal rev primer

ccagtctcagggtccgaggtattc

U6F

ctcgcttcggcagcaca

U6T

aacgcttcacgaatttgcgt

HOXA10 RT F

ctggtcccctccctctgtc

HOXA10 RT T

acaacaaataaaccagcaccaag

β-actin F

ccttcctgggcatggagtcct

β-actin T

aatctcatcttgttttctgcg


Chen et al. BMC Cancer 2012 12:111   doi:10.1186/1471-2407-12-111

Open Data