Table 1

Primers used for the analysis of the 9 SMARCB1 coding exons

Exon

Primer pair


1

5'CCCTCCTGATCCCTCGCAGC/5'CGGGCTACCTCGGAGCCGAT

2

5'CTGCGACCCTTATAATGAGC/5'GCGAGTGGTTTTGAAACAGG

3

5'ACCAGCAGAGTGACCCAGTG/5'AGAGATGCCCTGGCCAGGAA

4

5'GGATCAGGTCCTATACTGAC/5'AACTAAGGCGGAATCAGCAC

5

5'TTGCATACCTAGGGCTCCGG/5'GCCCGACTGCCTTGTACCAT

6

5'TGGTGCAATCTCTTGGCATC/5'TCAGTGCTCCATGATGACAC

7

5'TGGGCTGCAAAAGCTCTAAC/5'CGCTCACACAGAGAAGTCTT

8

5'ATCCACTGGGTGCCAGCAGT/5'TCTGCCTGGAAAGCCAGGTG

9

5'CCCTGTAGAGCCTTGGGAAG/5'GCCTCTGTCCTTGCCAGAAG


Rousseau et al. BMC Neurology 2011 11:9   doi:10.1186/1471-2377-11-9

Open Data