Open Access Research article

Antibodies to hepatitis B virus surface antigen and interleukin 12 and interleukin 18 gene polymorphisms in hemodialysis patients

Alicja E Grzegorzewska1*, Piotr M Wobszal1, Adrianna Mostowska2 and Paweł P Jagodziński2

Author Affiliations

1 Chair and Department of Nephrology, Transplantology and Internal Diseases Poznań University of Medical Sciences, 49 Przybyszewskiego Blvd, 60-355, Poznań, Poland

2 Department of Biochemistry and Molecular Biology, Poznań University of Medical Sciences, Poznań, Poland

For all author emails, please log on.

BMC Nephrology 2012, 13:75 doi:10.1186/1471-2369-13-75


The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2369/13/75


Received:2 November 2011
Accepted:28 July 2012
Published:3 August 2012

© 2012 Grzegorzewska et al.; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

The interleukin (IL)18 rs360719 CC genotype is associated with the development of antibodies to hepatitis B virus surface antigen (anti-HBs) in hemodialysis (HD) patients. IL18 shares biological properties with IL12 in promoting the T-hepler 1 (Th1) system. We studied whether polymorphisms in the IL12A 3` untranslated region (UTR) and IL12B 3`UTR may contribute to anti-HBs development (titre ≥ 10 IU/L) in HD patients either individually or jointly with the IL18 polymorphism.

Methods

In 518 HD patients and 240 controls the IL12A rs568408 3’UTR G > A polymorphism was genotyped by high-resolution melting curve analysis. Polymerase chain reaction restriction fragment length polymorphism was used to detect the IL12B rs3212227 3’UTR A > C and IL18 -1297 T > C rs360719 polymorphisms. The associations between the IL12A, IL12B and IL18 genotypes and the risk of impaired anti-HBs development were estimated by computing the odds ratios and their 95% confidence intervals using logistic regression analysis.

Results

In the logistic regression analysis, the higher frequency of rs360719 CC individually (2.9% in 207 patients without anti-HBs development vs 8.0% in 311 patients with anti-HBs development, p = 0.009) and of rs360719 CC combined with rs568408 GG (p = 0.048), rs568408 GA (p = 0.035), rs568408 GG/AA (p = 0.034) or rs3212227 AA (p = 0.046) was associated with an increased chance for the development of anti-HBs in HD patients. Patients bearing both rs568408 AA and rs360719 TT had a 10.9-fold or 8.9-fold lower chance, respectively, to develop anti-HBs compared with those carrying any other genotype (p = 0.005) or those who had both wild-type rs568408 GG and rs360719 TT (p = 0.011). Carriers of both rs3212227 CC and rs360719 TC had a 4.6-fold lower chance for anti-HBs development than carriers of any other genotype (p = 0.042).

Conclusion

Development of anti-HBs in HD patients is associated with gene polymorphisms of interleukins involved in the Th1 system.

Keywords:
Antibodies to surface antigen of hepatitis B virus; Gene polymorphisms; Hemodialysis; Interleukin 12; Interleukin 18

Background

Chronic kidney disease patients on intermittent hemodialysis (HD) have been known to exhibit impaired immune system function with regards to the formation of antibodies against hepatitis B virus surface antigen (anti-HBs). Cytokines, among them interleukin (IL) 12 and IL18, play a key role in the regulation of hepatitis B virus (HBV) clearance and the immune response to HBV antigens during spontaneous natural infection [1-4] or planned vaccination [5-9].

IL-12 is a heterodimeric cytokine formed by a 35,000 dalton (Da) light chain (known as p35) and a 40,000 Da heavy chain (known as p40). The subunits p35 and p40 of IL12 are encoded by IL12A and IL12B, respectively, which are located on separate chromosomes (3p12-q13.2 and 5q31-33). IL-18 is an 18,300 Da cytokine. The human IL-18 gene is located on chromosome 11q22.2_q22.3. IL-12 shares biological properties with IL-18, known as an interferon (IFN) -gamma inducing factor [10-13]. In mice, IL-12 p40 and IL-18 acted in concert in a poxvirus infection [14]. In other studies using IL12 p40−/− or IL18−/− mice, only IL-12 p40 or IL-18 was important for defense against human viruses adapted to the mouse [15,16]. In HD patients, the IL18 -1297CC rs360719 genotype, attributed to increased IL-18 secretion [17], was recently connected with the development of anti-HBs [18]. It is not known whether the IL12 genotype is concomitantly associated with the IL18 genotype in the development of anti-HBs.

The aim of our study was to determine whether polymorphisms in IL12A and IL12B may individually or jointly with the IL18 polymorphism contribute to anti-HBs development in HD patients. We have demonstrated that rs360719 CC individually and rs360719 CC combined with rs568408 GG, rs568408 GA, rs568408 GG/AA or rs3212227 AA are associated with an increased chance of developing anti-HBs in HD patients, whereas combined rs568408 AA and rs360719 TT or combined rs3212227 CC and rs360719 TC are associated with a lower chance of anti-HBs development. In HD the patients development of anti-HBs has been shown to be associated with gene polymorphisms of IL involved in the T-cell helper 1 (Th1) system.

Methods

Patients and controls

Studies were carried out in HD patients treated in 20 dialysis centers of the Wielkopolska region of Poland between February 11, 2009 and August 01, 2011. All patients with negative HBV seromarkers were vaccinated against HBV according to the standard rules for HD patients (4 vaccine doses of 40 μg each were given at 0–1–2–6 months) [19]; an anti-HBs titre was checked after 4–8 weeks from the last vaccine dose. An anti-HBs titre > 10 IU/L is assumed to be protective in vaccinated patients [20]. When an anti-HBs titre remained below 10 IU/L, vaccination against HBV was repeated. Due to fluctuations of anti-HBs in HD patients, blood testing for anti-HBs was repeated on a mandatory basis every 6 months to determine if vaccine booster doses were required.

Patients enrolled to the study had to fulfill the following criteria:

1. treatment with intermittent HD due to end-stage renal disease,

2. no signs and symptoms of acute infection with blood-borne viruses,

3. known anti-HBs titre (all available results of each patient were analyzed),

4. in patients without serological signs of HBV transmission, having an anti-HBs titre below 10 IU/L, two full vaccination series against HBV (4 doses of 40 μg each given at 0–1–2–6 months) had to be given or equivalent vaccine dosage had to be applied and the patients` anti-HBs titre had to be determined 4–8 weeks from the last vaccine dose,

5. from patients who disclosed a genetic relationship only one person could participate in the study,

6. written consent to participate in the study.

A response to HBsAg after vaccination or natural HBV transmission was considered to be positive when an anti-HBs titre exceeded 10 IU/L.

The inclusion criteria were fulfilled by 518 HD patients. These patients were divided into two groups dependent on anti-HBs development. Responders developed anti-HBs, whereas non-responders did not develop anti-HBs. Responders were the reference group for non-responders.

Group I (HBsAg non-responders, n = 207) included HD patients who did not develop an anti-HBs titre > 10 IU/L in response to HBsAg from the HBV vaccine [patients with negative total antibodies to HBV core antigen (anti-HBc), n = 177] or in response to HBsAg transmitted during natural HBV infection (patients with total anti-HBc positive, n = 30). The available medical documents for these patients did not reveal any anti-HBs > 10 IU/L.

Group II (HBsAg responders, n = 311) consisted of HD patients who developed an anti-HBs titre >10 IU/L as a result of vaccination (patients with total anti-HBc negative, n = 213) or as a result of HBV transmission (patients with total anti-HBc positive, n = 98). In some patients with a long course of renal disease, a history of vaccination effectiveness revealed periods with or without anti-HBs > 10 IU/L. If a patient had anti-HBs > 10 IU/L in the past but lost it during the course of renal disease, she/he was considered as constitutionally able to respond for HBsAg and was included into group II.

Registered blood donors from the Wielkopolska region of Poland (n = 240), qualified for blood donation according to the criteria of Polish Ministry of Health [21], served as controls for HD patients. The control persons had serum alanine aminotransferase activity not higher than 2 times the upper normal limit of the applied laboratory method. All controls showed negative blood testing for HBsAg and HBV DNA as well as for seromarkers of infection with the hepatitis C virus. Unfortunately, the vaccination rate against HBV and an anti-HBs titre were not known in these healthy individuals.

Genotype analysis for rs568408 3`UTR G > A in IL12A, rs3212227 3`UTR A > C in IL12B and -1297 C/T rs360719 in IL18 was done in all HD patients and controls.

Laboratory methods

HBsAg and anti-HBc were determined by Microparticle Enzyme Immunoassay (MEIA) technology (AxSYM, Abbott Laboratories, Abbott Park, USA). MEIA technology (ABBOTT, Wiesbaden, Germany) was also used for detection of anti-HBs and antibodies to hepatitis C virus (anti-HCV). HBV DNA was determined using a qualitative test COBAS AMPLICOR HBV MONITOR; HCV RNA was tested using COBAS AMPLICOR Hepatitis C Virus Test, version 2.0 (both Roche Diagnostics Ltd., Rotkreutz, Switzerland). Serum activities of liver enzymes were determined by routine laboratory methods.

IL12A, IL12B and IL18 genotyping

DNA was isolated from peripheral leukocytes using a standard salting out procedure.

The IL12A 3’UTR G > A (rs568408) DNA fragments were amplified using primers 5’ ATGAGGAAACTTTGATAGGATG 3’ and 5’TTCCCTTCTTAGCAATTCATTC 3’. This polymorphism was then genotyped by high-resolution melting curve analysis (HRM) using the Light Cycler 480 system (Roche Diagnostics, Mannheim, Germany).

Identification of the IL12B 3’UTR A > C (rs3212227) and IL-18 -1297 T > C (rs360719) polymorphic variants was carried out by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). PCR for IL12B 3’UTR A > C (rs3212227) was conducted using the primer pair 5’ TTAAAGACACAACGGAATAGAC 3’and 5’ TGCTTTATCAACACCATCTCC 3’. The PCR-amplified fragments of IL12B that were 557 bp in length were isolated and digested with the endonuclease TaqI (T/CGA) (New England Biolabs, Ipswich, USA). The IL12B 3’UTR A allele remained uncut whereas the IL12B 3’UTR C allele was cleaved into 454 bp and 103 bp fragments. PCR for IL-18 -1297 T > C (rs360719) was conducted using the primer pair 5’ CAACAGTGATTACAAAGGAAGT 3’ and 5’ TAAATGGGTAGGAATAAGTGAGA 3’. The PCR-amplified fragments of IL-18 474 bp in length were digested with endonuclease NlaIII (CATG/) (New England Biolabs, Ipswich, USA). The IL-18 C allele remained uncut, whereas the IL-18 T allele was cleaved into 295 bp and 179 bp fragments. DNA digestion products for the IL12B 3'UTR A > C and IL-18 -1297 T > C polymorphisms were separated by electrophoresis on 2% agarose gel and visualized by ethidium bromide staining. The PCR-RFLP analysis was repeated for all patient and control samples.

For quality control of the tested polymorphisms, approximately 10% of the randomly chosen samples were re-genotyped using commercial sequencing.

Statistical methods

Differences in the distributions of demographic characteristics and selected variables between the examined groups were analyzed. The normality of distribution of variables was checked by the Shapiro-Wilk test. Descriptive statistics are presented as percentage for categorical variables, as mean with one standard deviation for normally distributed continuous variables or as median with range for not normally distributed continuous variables. The prevalence of variables was assessed by the chi square (χ2) test or Yates` test, as appropriate. Results were compared using Student’s t-test for non-paired data if distribution of variables was normal or the Mann–Whitney U-test for other than normal distributions.

Hardy-Weinberg equilibrium was tested by a goodness-of-fit m2 test to compare the observed genotype frequencies to the expected ones. Power analysis was conducted employing the Fisher exact test, which was available at an on-line internet service, http://biostat.mc.vanderbilt.edu/twiki/bin/view/Main/ webcite PowerSampleSize.

The associations between the IL12A, IL12B and IL18 genotypes and risk of impaired anti-HBs development were estimated by computing the odds ratios (OR) and their 95% confidence intervals (95% CI) using logistic regression analysis. To address the possibility of a gene-gene interaction effect between analyzed polymorphisms, a Multifactor Dimensionality Reduction (MDR) approach (MDR version 2.0 beta 5) was used [22].

Values of P < 0.05 were judged to be significant.

Ethical issues

This study was approved by the Institutional Review Board of Poznań University of Medical Sciences, Poland.

Results

The selected demographic, clinical and laboratory data of groups I (non-responders) and II (responders) are shown in Table 1. All patients were Caucasian. The patients in group I were significantly older and had shorter duration of renal replacement therapy (RRT). Among the 4 main causes of end-stage renal disease in groups I and II diabetic nephropathy was the most frequent with the least frequent being chronic glomerulonephritis in group I and chronic tubulointerstitial nephritis in group II. Significant differences in HBV seromarkers between groups resulted from categorization of patients to groups I or II.

Table 1. Data of all patients and of subjects grouped by a titre of antibodies to surface antigen of hepatitis B virus ≤ 10 UI/L (Group I) and > 10 UI/L (Group II)

There was no significant deviation from Hardy-Weinberg equilibrium in the genotype frequencies in HD patients of groups I and II (Table 2), and in controls (Table 3).

Table 2. IL12 and IL18 polymorphisms in hemodialysis patients with a titre of antibodies to surface antigen of hepatitis B virus ≤ 10 UI/L (Group I) and > 10 UI/L (Group II)

Table 3. IL12 and IL18 polymorphisms in hemodialysis patients with a titre of antibodies to surface antigen of hepatitis B virus ≤ 10 UI/L (Group II) and controls

The logistic regression analysis (Table 2), performed in HD patients with a titre of anti-HBs ≤ 10 UI/L (Group I) or > 10 UI/L (Group II), revealed that a lower frequency of the rs360719 CC genotype was individually associated with a significantly increased risk of immune non-responsiveness to HBsAg. The rs360719 CC variant was associated with a 3.13-fold increased chance to develop anti-HBs in HD patients (P = 0.009). The logistic regression analysis (Table 3), performed in HD patients with a titre of anti-HBs ≤ 10 UI/L (Group I) and controls, also revealed that a lower frequency of the rs360719 CC variant was associated with a significantly (P = 0.006) increased risk of immune non-responsiveness to HBsAg compared with the rs360719 TT variant.

Selected combined or dichotomized effects of the IL12A rs568408 3`UTR G > A, IL12B rs3212227 3’UTR A > C and -1297 T > C (rs360719) IL-18 variants on the development of anti-HBs in HD patients are shown in Tables 4 and 5, respectively. A higher frequency of rs360719 CC combined with rs568408 GG, rs568408 GA or rs568408 GG/AA was associated in HD patients with a significantly higher chance to develop anti-HBs (P = 0.048, P = 0.035 and P = 0.034, respectively) compared to HD patients having both wild-type genotypes (rs568408 GG and rs360719 TT). A higher frequency of 360719 CC combined with rs3212227 AA was also associated with anti-HBs development in HD patients (P = 0.046) compared to HD patients bearing both rs3212227 AA and rs360719 TT. Combined rs568408 AA and rs360719 TT were associated with an 8.94-fold increased risk of non-responsiveness (anti-HBs < 10 IU/L) (P = 0.011) compared to the combined effects of rs568408 GG and rs360719 TT (Table 4) and with a 10.85-fold elevated risk of non-responsiveness (P = 0.005) compared to all other genotypes (Table 5). Combined rs3212227 CC and rs360719 TC were associated with a 4.61-fold increased risk of non-responsiveness (P = 0.042) compared to all other genotypes (Table 5). There were no significant effects of having the combined rs568408 and rs3212227 variants.

Table 4. The selected combined effects of IL12 and IL18 polymorphisms in hemodialysis patients with a titre of antibodies to surface antigen of hepatitis B virus ≤ 10 UI/L (Group I) and > 10 UI/L (Group II)

Table 5. Selected dichotomized effects of IL12A rs568408 and IL18 rs360719 in hemodialysis patients with a titre of antibodies to surface antigen of hepatitis B virus ≤ 10 UI/L (Group I) and > 10 UI/L (Group II)

MDR approach revealed a borderline gene-gene interaction effect between the analyzed polymorphic variants of IL12A, IL12B and IL18 in HD patients of both groups (testing balance accuracy = 0.556, p = 0.094).

Discussion

Vaccination against HBV resulting in the formation of an anti-HBs titre conferring protection (over 10 IU/L [20]) was reported in only 54% – 86% of HD patients using a recombinant vaccine [23-26]. HD patients that do not respond to vaccination are susceptible to HBV infection. Natural HBV transmission, if it does not lead to anti-HBs development, results in:

1. HBsAg carrier status, which is usually associated with persistent HBV replication (in this study HBV DNA was detected in all HBsAg positive patients) and infectivity to other persons,

2. occurrence of isolated anti-HBc positivity (anti-HBc positive persons are both HBsAg and anti-HBs negative), which is associated in approximately 8% of cases with HBV DNA detectable in the blood [27].

Moreover, an anti-HBs titre > 10 IU/L in HD patients is not always protective against HBV infection and seroconversions to anti-HBc positivity, also without clinical signs of disease, may occur [28].

Prevalence of HBsAg carrier status or isolated anti-HBc positivity in HD patients varies between individual HD facilities. As shown in this study, HBsAg carriers amounted for 3.1% of all HD patients and isolated anti-HBc positivity occurred in 13.3% of the anti-HBc positive HD patients. As such frequencies are in the medium range [26,29-31], these results indicate thousands of affected HD people worldwide.

The reasons of non-responsiveness to HBsAg are not fully understood. It has been shown that effective seroconversion after vaccination of HD patients depends on age, body mass, serum albumin concentration, type of dialyzer, duration of RRT, and underlying kidney disease [18,32-36]. Such risk factors of non-responsiveness as older age, shorter RRT duration and diabetic nephropathy were also present in the examined non-responders compared to responders.

Genetic aspects of responsiveness to HBsAg were also taken into account, linking responsiveness with the human leukocyte antigen system [37,38]. More recently, IL genotypes (IL10IL-18) were associated with anti-HBs development in response to HBsAg in HD patients [18,39].

IL12 and IL18 share biological properties through their synergism in the promotion of IFN-gamma production [11-13,40,41]. IL12, generated by macrophages, monocytes, dendritic cells, and B cells, is significantly elevated in HD patients [42-46], but despite this increase a constitutive IFN-gamma release by peripheral blood mononuclear cells (PBMCs) of HD patients may be undetectable [45]. Plasma levels of free IL18 are also increased in dialysis patients [47], but Th1 lymphocyte immunodeficiency was reported owing to the deficit of IFN-gamma [44,47]. Thereby, genes promoting expression of these IL may be helpful under specific clinical conditions. In experimental studies, mice immunized with an HBV DNA vaccine and the DNA fragments containing the p35 and p40 coding sequences of murine IL-12 demonstrated increased production of both immunoglobulin (Ig) M and IgG anti-HBs titers [5]. Mice vaccinated with a recombinant plasmid carrying the gene encoding HBsAg linked to a DNA segment encoding full-length murine IL18 revealed significant serum anti-HBs IgG response after two intramuscular injections [8]. These effects may be related to the indirect influence of these cytokines on anti-HBs development, may be mediated through the observed increased INF-gamma production or both. In this study neither the IL12A rs568408 nor the IL12B rs3212227 polymorphic variants were individually associated with anti-HBs development in the examined HD patients as was shown for IL18 rs360719 CC. However, patients bearing the IL18 rs360719 CC genotype had a greater chance to develop anti-HBs also when occurring concomitantly with the IL12A rs568408 GG, IL12A rs568408 GA or rs3212227 AA polymorphic variants, but the IL12A rs568408 AA and IL12B rs3212227 CC variants occurring together with other than the CC variant of IL18 rs360719 were negatively associated with anti-HBs development.

Liu et al.. [48] using http://pupasuite.bioinfo.cipf.es/ webcitehttp://exon.cshl.edu/ESE/ webcite and http://genes.mit.edu/burgelab/rescueese webcite found that rs568408 may disrupt exonic splicing enhancers. They hypothesized that IL12 mRNA may be unstable or that IL12 secretion may be lower due to disrupted exonic splicing, which was suggested as a functional characterization of IL12A rs568408. Decreased IL12 secretion results in lower INF-gamma levels [41]. Liu et al. [48] showed that the IL12A rs568408 AA and IL12A rs568408 GA/AA genotypes were more frequent in patients suffering from hepatocellular carcinoma compared to controls. These patients were HBsAg positive in 73.5% of cases, thereby, near exclusively anti-HBs negative, whereas controls were HBsAg positive in 12.6% of cases. Although the anti-HBs titre is not mentioned in the study by Liu et al. [48], their data directly indicate that A allele of IL12A is associated with a lack of anti-HBs development. In our study, HD patients with an anti-HBs titre ≤ 10 IU/L had a higher frequency of IL12A rs568408 AA in association with IL18 rs360719 TT than did HD patients with anti-HBs titre > 10 IU/L. Studies by Sánchez et al. [17] indicate that inhibitory transcription factor OCT-1 binds to the T allele but not to the C allele at position −1297 (rs360719). The rs360719 T allele was identified as a possible major repressor site in the IL-18 promoter. This suppression would result in reduced IL-18 production.

Functional characterization of IL12B rs3212227 3’UTR A/C is not clear. Morahan et al. [49] observed that the rs3212227AA genotype was associated with a significantly elevated expression of IL12 in Epstein-Barr virus transformed human cell lines. Similar results were reported using peripheral lymphocytes: the expression of the 1159A allele was approximately 50% higher than that of the 1159 C allele [50]. On the other hand, Seegers et al. [51] correlated a TaqI polymorphism (C/C) in IL-12B p40 3`UTR with increased IL-12B p70 secretion by stimulated monocytes. Additionally, Yilmaz et al. [52] associated the 1188A/C polymorphism in the 3`UTR of the IL-12B gene with the expression of IL-12B mRNA and IL-12B secretion level from lipopolysaccharide (LPS) and purified protein derivative (PPD) stimulated PBMCs. Individuals +16974CC homozygous at the IL12B 3'UTR had significantly higher IL-12 secretion levels from LPS and PPD stimulated PBMCs than AC heterozygotes or AA homozygotes [52]. Sánchez et al. [17] found a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 C allele. As shown in this study, combined effects of IL-18 rs360719 CC and IL12B rs3212227 AA were positively associated with anti-HBs development. In this case, an elevated expression of IL18 could be accompanied by increased expression of IL12B. Thereby, our results confirm previous results indicating that IL12B rs3212227 AA is associated with elevated IL12 levels [49,50].

It has been discussed that genetic investigations could help in the development of new and improved vaccines against HBV and may eventually reduce the proportion of vaccine failures [53]. It has been shown that the use of exogenous IL12 as an adjuvant to augment anti-HBs development in response to vaccines against HBV [54,55] may help overcome at least some immunologic deficits of genetic origin. There are also experimental studies that take advantage of the recombinant plasmid carrying gene encoding the HBsAg linked to DNA segment encoding full-length murine IL18 [8]. We have suggested such a vaccine for non-responders bearing other IL18 polymorphic variants than −1297 CC rs360719 [18]. However, at present we are very careful in our conclusions, because associations that have been found between polymorphic variants of genes encoding cytokines may disturb the unique homeostasis between cytokines with opposing action. Thus, practical significance of the obtained results cannot yet be declared, although it does indicate a necessity and implications for further studies.

There are some limitations of our study which need to be addressed. The measurement of IL12A, Il12B, IL18 and INF-gamma serum concentrations, especially during vaccination or natural HBV transmission, was not possible due to a lack of patient material, although it could provide further information on mechanisms of anti-HBs formation in relation to the respective genotypes. An other limitation of our study is the moderate number of the examined patients, especially since genetic influences on responsiveness to HBsAg with anti-HBs development were shown in homozygotes carrying polymorphic variants of low frequency, which limits the statistical power of the study. Numerous analyses showed borderline significance and were not used to support our conclusion, as they may indicate the involvement of ILs of the Th1 pathway in the immune response to HBsAg. Therefore, large population-based studies are warranted to further elucidate the impact of the examined IL polymorphisms on anti-HBs development. Finally, we would like to stress that our results were obtained in Caucasian HD patients living in the Wielkopolska region of Poland. Prevalence of rare homozygotes of both IL12 and IL18 may vary in other ethnicities. The frequency of the IL12A rs568408 AA polymorphism in a Chinese control population was 1.2%, and 18.7% for IL12B rs3212227 CC [48], whereas in our Caucasian controls the respective frequencies were 2.5% and 5.0%. Prevalence of IL18 rs360719 CC was 5.7%, 5.5% and 6.1% in Spain, Italy and Argentina, respectively [17]. In controls from the South Moravia region (more proximal to Poland), the IL18 rs360719 CC frequency was 8.0% [56]; in our study this frequency was 8.8%. The ethnic differences in IL genotype prevalence may modulate the effect of ILs on the humoral and cellular immune response, but further investigations are needed for IL12 and IL18.

Conclusions

1. Polymorphisms in IL12A and IL12B may jointly with IL18 polymorphism contribute to anti-HBs development in HD patients.

2. In HD patients, the development of anti-HBs is associated with gene polymorphisms of ILs involved in the Th1 system.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

AEG gave a conception, participated in the design of the study, performed a clinical interpretation of the data and wrote the manuscript. PMW performed the statistical analysis and participated in its interpretation. AM performed MDR analysis and interpreted its results. PPJ carried out the molecular genetic studies and participated in the study design. All authors read and approved the final manuscript.

Acknowledgements

We would like to express our gratitude to physicians of the dialysis centers of the Wielkopolska region of Poland for their help in collecting the participants' data and consent during the study period. We would also like to thank Dr. Margarita Lianeri for her assistance.

For the abstract of this paper we received the Best Hemodialysis Abstract Award at the 18th International Symposium on Hemodialysis, 32nd Annual Dialysis Conference in San Antonio, February 25, 2012.

References

  1. Cooksley H, Chokshi S, Maayan Y, Wedemeyer H, Andreone P, Gilson R, Warnes T, Paganin S, Zoulim F, Frederick D, Neumann AU, Brosgart CL, Naoumov NV: Hepatitis B virus e antigen loss during adefovir dipivoxil therapy is associated with enhanced virus-specific CD4+ T-cell reactivity.

    Antimicrob Agents Chemother 2008, 52:312-320. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  2. Wu JF, Wu TC, Chen CH, Ni YH, Chen HL, Hsu HY, Chang MH: Serum levels of interleukin-10 and interleukin-12 predict early, spontaneous hepatitis B virus e antigen seroconversion.

    Gastroenterology 2010, 138:165-172. PubMed Abstract | Publisher Full Text OpenURL

  3. Rossol S, Marinos G, Carucci P, Singer MV, Roger W, Naoumov NV: Interleukin-12 induction of Th1 cytokines is important for viral clearance in chronic hepatitis B.

    J Clin Invest 1997, 99:3025-3033. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  4. Cheong JY, Cho SW, Oh B, Kimm K, Lee KM, Shin SJ, Lee JA, Park BL, Cheong HS, Shin HD, Cho BY, Kim JH: Association of interleukin-18 gene polymorphisms with hepatitis B virus clearance.

    Dig Dis Sci 2010, 55:1113-1119. PubMed Abstract | Publisher Full Text OpenURL

  5. Chow YH, Chiang BL, Lee YL, Chi WK, Lin WC, Chen YT, Tao MH: Development of Th1 and Th2 populations and the nature of immune responses to hepatitis B virus DNA vaccines can be modulated by codelivery of various cytokine genes.

    J Immunol 1998, 160:1320-1329. PubMed Abstract | Publisher Full Text OpenURL

  6. Schirmbeck R, Reimann J: Modulation of gene-gun-mediated Th2 immunity to hepatitis B surface antigen by bacterial CpG motifs or IL-12.

    Intervirology 2001, 44:115-123. PubMed Abstract | Publisher Full Text OpenURL

  7. Chen JZ, Zhu HH, Liu KZ, Chen Z: Enhancing cellular immune response to HBV M DNA vaccine in mice by codelivery of interleukin-18 recombinant.

    J Zhejiang Univ Sci 2004, 5:467-471. PubMed Abstract | Publisher Full Text OpenURL

  8. Channarong S, Mitrevej A, Sinchaipanid N, Usuwantim K, Kulkeaw K, Chaicumpa W: Cloning, protein expression and immunogenicity of HBs-murine IL-18 fusion DNA vaccine.

    Asian Pac J Allergy Immunol 2007, 25:233-242. PubMed Abstract OpenURL

  9. Tang LL, Liu KZ: Recent advances in DNA vaccine of hepatitis virus.

    Hepatobiliary Pancreat Dis Int 2002, 1:228-231. PubMed Abstract | Publisher Full Text OpenURL

  10. Okamura H, Tsutsi H, Komatsu T, Yutsudo M, Hakura A, Tanimoto T, Torigoe K, Okura T, Nukada Y, Hattori K, et al.: Cloning of a new cytokine that induces IFN-gamma production by T cells.

    Nature 1995, 378:88-91. PubMed Abstract | Publisher Full Text OpenURL

  11. Yoshimoto T, Takeda K, Tanaka T, Ohkusu K, Kashiwamura S, Okamura H, Akira S, Nakanishi K: IL-12 up-regulates IL-18 receptor expression on T cells, Th1 cells, and B cells: synergism with IL-18 for IFN-gamma production.

    J Immunol 1998, 161:3400-3407. PubMed Abstract | Publisher Full Text OpenURL

  12. Tominaga K, Yoshimoto T, Torigoe K, Kurimoto M, Matsui K, Hada T, Okamura H, Nakanishi K: IL-12 synergizes with IL-18 or IL-1beta for IFN-gamma production from human T cells.

    Int Immunol 2000, 12:151-160. PubMed Abstract | Publisher Full Text OpenURL

  13. Kim JJ, Nottingham LK, Tsai A, Lee DJ, Maguire HC, Oh J, Dentchev T, Manson KH, Wyand MS, Agadjanyan MG, Ugen KE, Weiner DB: Antigen-specific humoral and cellular immune responses can be modulated in rhesus macaques through the use of IFN-gamma, IL-12, or IL-18 gene adjuvants.

    J Med Primatol 1999, 28:214-223. PubMed Abstract | Publisher Full Text OpenURL

  14. Yang W, Chaudhri G, Jackson RJ, Karupiah G: IL-12p40 and IL-18 play pivotal roles in orchestrating the cell-mediated immune response to a Poxvirus infection.

    J Immunol 2009, 183:3324-3331. PubMed Abstract | Publisher Full Text OpenURL

  15. Reading PC, Whitney PG, Barr DP, Wojtasiak M, Mintern JD, Waithman J, Brooks AG: IL-18, but not IL-12, regulates NK cell activity following intranasal herpes simplex virus type 1 infection.

    J Immunol 2007, 179:3214-3221. PubMed Abstract | Publisher Full Text OpenURL

  16. Harandi AM, Svennerholm B, Holmgren J, Eriksson K: Interleukin-12 (IL-12) and IL-18 are important in innate defense against genital herpes simplex virus type 2 infection in mice but are not required for the development of acquired gamma interferon-mediated protective immunity.

    J Virol 2001, 75:6705-6709. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  17. Sánchez E, Palomino-Morales RJ, Ortego-Centeno N, Jiménez-Alonso J, González-Gay MA, López-Nevot MA, Sánchez-Román J, de Ramón E, González-Escribano MF, Pons-Estel BA, D'Alfonso S: Sebastiani GD; Italian collaborative group, Alarcón-Riquelme ME, Martín J: Identification of a new putative functional IL18 gene variant through an association study in systemic lupus erythematosus.

    Hum Mol Genet 2009, 18:3739-3748. PubMed Abstract | Publisher Full Text OpenURL

  18. Grzegorzewska AE, Wobszal P, Jagodziński PP: Interleukin-18 Promoter polymorphism and development of antibodies to surface antigen of hepatitis B virus in hemodialysis patients.

    Kidney Blood Press Res 2012, 35:1-8. PubMed Abstract | Publisher Full Text OpenURL

  19. Recommendations for preventing transmission of infections among chronic hemodialysis patients: Morbidity and Mortality Weekly report. Centers for Disease Control and Prevention: Centers for Disease Control and Prevention; 2001:50. OpenURL

  20. Guidelines EBP: Prevention and management of HBV, HCV and HIV in HD patients.

    Nephrol Dial Transplant 2002, 17:78-87. PubMed Abstract | Publisher Full Text OpenURL

  21. Załączniki do rozporządzenia Ministra Zdrowia z dnia 18 kwietnia

    2005.

  22. Hahn LW, Ritchie MD, Moore JH: Multifactor dimensionality reduction software for detecting gene-gene and gene-environment interactions.

    Bioinformatics 2003, 19:376-382. PubMed Abstract | Publisher Full Text OpenURL

  23. Bruguera M, Cremades M, Mayor A, Sánchez Tapias JM, Rodés J: Immunogenicity of a recombinant hepatitis B vaccine in haemodialysis patients.

    Postgrad Med J 1987, 63S(2):155-158. OpenURL

  24. Mitwalli A: Responsiveness to hepatitis B vaccine in immunocompromised patients by doubling the dose scheduling.

    Nephron 1996, 73:417-420. PubMed Abstract OpenURL

  25. Sorkhi H, Roushan MR: Al Hashemi GH, Dooki MR, Bai S: Response to hepatitis B virus vaccination in haemodialysis patients with and without hepatitis C infection.

    East Mediterr Health J 2008, 14:798-803. PubMed Abstract OpenURL

  26. Fabrizi F, Messa PG, Lunghi G, Aucella F, Bisegna S, Mangano S, Villa M, Barbisoni F, Rusconi E, Martin P: Occult hepatitis B virus infection in dialysis patients: a multicentre survey.

    Aliment Pharmacol Ther 2005, 21:1341-1347. PubMed Abstract | Publisher Full Text OpenURL

  27. Sun HY, Lee HC, Liu CE, Yang CL, Su SC, Ko WC, Lin CY, Tsai JJ, Wong WW, Ho MW, Cheng SH, Lin YH, Miao WJ, Hung CC: Factors associated with isolated anti-hepatitis B core antibody in HIV-positive patients: impact of compromised immunity.

    J Viral Hepat 2010, 17:578-587. PubMed Abstract | Publisher Full Text OpenURL

  28. Grzegorzewska AE, Kaczmarek-Leki V, Młot-Michalska M, Niepolski L: Seroconversion rate to positivity for antibodies against core antigen of hepatitis B virus and duration of renal replacement therapy.

    Nephrol Dial Transplant 2011, 26:970-976. PubMed Abstract | Publisher Full Text OpenURL

  29. Oesterreicher C, Hammer J, Koch U, Pfeffel F, Sunder-Plassmann G, Petermann D, Müller C: HBV and HCV genome in peripheral blood mononuclear cells in patients undergoing chronic hemodialysis.

    Kidney Int 1995, 48:1967-1971. PubMed Abstract | Publisher Full Text OpenURL

  30. Minuk GY, Sun DF, Greenberg R, Zhang M, Hawkins K, Uhanova J, Gutkin A, Bernstein K, Giulivi A, Osiowy C: Occult hepatitis B virus infection in a North American adult hemodialysis patient population.

    Hepatology 2004, 40:1072-1077. PubMed Abstract | Publisher Full Text OpenURL

  31. Grzegorzewska AE, Kurzawska-Firlej D, Ratajewski W, Frankiewicz D, Niepolski L, Kaczmarek A: Antibodies to core antigen of hepatitis B virus in patients on renal replacement therapy: Association with demographic, clinical and laboratory data.

    Nephron Clin Pract 2010, 114:c194-c203. PubMed Abstract | Publisher Full Text OpenURL

  32. Fabrizi F, Dixit V, Martin P, Messa P: Meta-analysis: the impact of diabetes mellitus on the immunological response to hepatitis B virus vaccine in dialysis patients.

    Aliment Pharmacol Ther 2011, 33:815-821. PubMed Abstract | Publisher Full Text OpenURL

  33. Shatat HZ, Kotkat AM, Farghaly AG: Immune response to hepatitis B vaccine in haemodialysis patients.

    J Egypt Public Health Assoc 2000, 75:257-275. PubMed Abstract OpenURL

  34. Steketee RW, Ziarnik ME, Davis JP: Seroresponse to hepatitis B vaccine in patients and staff of renal dialysis centers, Wisconsin.

    Am J Epidemiol 1988, 127:772-782. PubMed Abstract | Publisher Full Text OpenURL

  35. Fabrizi F, Di Filippo S, Marcelli D, Guarnori I, Raffaele L, Crepaldi M, Erba G, Locatelli F: Recombinant hepatitis B vaccine use in chronic hemodialysis patients.

    Long-term evaluation and cost-effectiveness analysis. Nephron 1996, 72:536-543. OpenURL

  36. He Q, Wu F, Zhang P, Chen J: Effect of high-flux hemodialysis on delayed hepatitis B virus vaccination response in hemodialysis patients.

    Postgrad Med 2011, 123:150-152. PubMed Abstract | Publisher Full Text OpenURL

  37. Watanabe H, Matsushita S, Kamikawaji N, Hirayama K, Okumura M, Sasazuki T: Immune suppression gene on HLA-Bw54-DR4-DRw53 haplotype controls nonresponsiveness in humans to hepatitis B surface antigen via CD8+ suppressor T cells.

    Hum Immunol 1988, 22:9-17. PubMed Abstract | Publisher Full Text OpenURL

  38. Hatae K, Kimura A, Okubo R, Watanabe H, Erlich HA, Ueda K, Nishimura Y, Sasazuki T: Genetic control of nonresponsiveness to hepatitis B virus vaccine by an extended HLA haplotype.

    Eur J Immunol 1992, 22:1899-1905. PubMed Abstract | Publisher Full Text OpenURL

  39. Girndt M, Sester U, Sester M, Deman E, Ulrich C, Kaul H, Köhler H: The interleukin-10 promoter genotype determines clinical immune function in hemodialysis patients.

    Kidney Int 2001, 60:2385-2391. PubMed Abstract | Publisher Full Text OpenURL

  40. Seder RA, Gazzinelli R, Sher A, Paul WE: IL-12 acts directly on CD41 T cells to enhance priming for IFN-g production and diminishes IL-4 inhibition in such priming.

    Proc Natl Acad Sci USA 1993, 90:10188-10192. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  41. Wysocka M, Kubin M, Vieira LQ, Ozmen L, Garotta G, Scott P, Trinchieri G: Interleukin-12 is required for interferon-gamma production and lethality in lipopolysaccharide-induced shock in mice.

    Eur J Immunol 1995, 25:672-676. PubMed Abstract | Publisher Full Text OpenURL

  42. Cheema BS, Abas H, Smith BC, O'Sullivan AJ, Chan M, Patwardhan A, Kelly J, Gillin A, Pang G, Lloyd B, Berger K, Baune BT: Fiatarone Singh MA: Effect of resistance training during hemodialysis on circulating cytokines: a randomized controlled trial.

    Eur J Appl Physiol 2011, 111:1437-1445. PubMed Abstract | Publisher Full Text OpenURL

  43. Ishizuka T, Nitta K, Yokoyama T, Hayashi T, Futatsuyama K, Kimata N, Miwa N, Nishida E, Kawashima A, Akiba T, Nihei H: Increased serum levels of interleukin-12 may be associated with Th1 differentiation in hemodialysis patients.

    Nephron 2002, 90:503-504. PubMed Abstract | Publisher Full Text OpenURL

  44. Klínger J, Enríquez J, Arturo JA, Delgado M, Avila G, Ceballos O: Cytokines and peritonitis in continuous ambulatory peritoneal dialysis: immunodeviation and immunodeficiency.

    Adv Perit Dial 2002, 18:170-176. PubMed Abstract OpenURL

  45. Libetta C, Rampino T: Dal Canton A: Polarization of T-helper lymphocytes toward the Th2 phenotype in uremic patients.

    Am J Kidney Dis 2001, 38:286-295. PubMed Abstract | Publisher Full Text OpenURL

  46. Sester U, Sester M, Hauk M, Kaul H, Köhler H, Girndt M: T-cell activation follows Th1 rather than Th2 pattern in haemodialysis patients.

    Nephrol Dial Transplant 2000, 15:1217-1223. PubMed Abstract | Publisher Full Text OpenURL

  47. Lonnemann G, Novick D, Rubinstein M, Dinarello CA: Interleukin-18, interleukin-18 binding protein and impaired production of interferon-gamma in chronic renal failure.

    Clin Nephrol 2003, 60:327-334. PubMed Abstract OpenURL

  48. Liu L, Xu Y, Liu Z, Chen J, Zhang Y, Zhu J, Liu J, Liu S, Ji G, Shi H, Shen H, Hu Z: IL12 polymorphisms, HBV infection and risk of hepatocellular carcinoma in a high-risk Chinese population.

    Int J Cancer 2011, 128:1692-1696. PubMed Abstract | Publisher Full Text OpenURL

  49. Morahan G, Huang D, Ymer SI, Cancilla MR, Stephen K, Dabadghao P, Werther G, Tait BD, Harrison LC, Colman PG: Linkage disequilibrium of a type 1 diabetes susceptibility locus with a regulatory IL12B allele.

    Nat Genet 2001, 27:218-221. PubMed Abstract | Publisher Full Text OpenURL

  50. Davoodi-Semiromi A, Yang JJ, She JX: IL-12p40 is associated with type 1 diabetes in Caucasian-American families.

    Diabetes 2002, 51:2334-2336. PubMed Abstract | Publisher Full Text OpenURL

  51. Seegers D, Zwiers A, Strober W, Peña AS, Bouma G: Taq I polymorphism in the 3_-UTR of the IL-12 p40 gene correlates with increased IL-12 secretion.

    Genes Immun 2002, 3:419-423. PubMed Abstract | Publisher Full Text OpenURL

  52. Yilmaz V, Yentür SP, Saruhan-Direskeneli G: IL-12 and IL-10 polymorphisms and their effects on cytokine production.

    Cytokine 2005, 30:188-194. PubMed Abstract | Publisher Full Text OpenURL

  53. Hennig BJ, Fielding K, Broxholme J, Diatta M, Mendy M, Moore C, Pollard AJ, Rayco-Solon P, Sirugo G, van der Sande MA, Waight P, Whittle HC, Zaman SM, Hill AV, Hall AJ: Host genetic factors and vaccine-induced immunity to hepatitis B virus infection.

    PLoS One 2008, 3:e1898. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  54. Du DW, Jia ZS, Li GY, Zhou YY: HBV DNA vaccine with adjuvant cytokines induced specific immune responses against HBV infection.

    World J Gastroenterol 2003, 9:108-111. PubMed Abstract | Publisher Full Text OpenURL

  55. Livingston BD, Alexander J, Crimi C, Oseroff C, Celis E, Daly K, Guidotti LG, Chisari FV, Fikes J, Chesnut RW, Sette A: Altered helper T lymphocyte function associated with chronic hepatitis B virus infection and its role in response to therapeutic vaccination in humans.

    J Immunol 1999, 162:3088-3095. PubMed Abstract | Publisher Full Text OpenURL

  56. Izakovicova Holla L, Hrdlicková B, Schüller M, Buckova D, Kindlova D, Izakovic V, Vasku A: Haplotype analysis of the interleukin-18 gene in Czech patients with allergic disorders.

    Hum Immunol 2010, 71:592-597. PubMed Abstract | Publisher Full Text OpenURL

Pre-publication history

The pre-publication history for this paper can be accessed here:

http://www.biomedcentral.com/1471-2369/13/75/prepub