Table 2

Information of Primers and Probes Used for qRT-PCR
Fragment Primers Probe Amplify length
SMN1 SMN_mgb-F: 5TGGTACATGAGTGGCTATCATACTG3 5FAM-ATGGGTTTCAGAA-MGB-NFQ 75 bp
SMN_mgb-R: 5 GTGAGCACCTTCCTTCTTTTT3
SMN2 SMN_mgb-F: 5TGGTACATGAGTGGCTATCATACTG3 5′FAM-ATGGGTTTTAGAA-MGB-NFQ 75 bp
SMN_mgb-R: 5 GTGAGCACCTTCCTTCTTTTT3
GAPDH[26] GAPDH_abs-F:5GGGTGTGAACCATGAGAAGTATGA-3 5′FAM-CAAGATCATCAGCAATGC-NFQ3 73 bp
GAPDH_abs-R: 5CTAAGCAGTTGGTGGTGCAGG-3

The bases C and T in bold are specific for SMN1 and SMN2, respectively. The primers and probe sequences of GAPDH are described by Tiziano FD et al. [26].

Yu-jin et al.

Yu-jin et al. BMC Medical Genetics 2012 13:86   doi:10.1186/1471-2350-13-86

Open Data