Table 1

Description of PCR Assays

GENE

SNP I.D. or description

MTHFR

rs1801133

TYMS

5'UTR EX1+52CCGCGCCACTTC

GCTGCCTCCGTCCCC


Rare allelic form

(amino acid changes)

677C>T (A222V)

2R

[17]


Sense primer and antisense primer

GGGTCAGAAGCATATCAGTCATG

CACAAAGCGGAAGAATGTGTC

AAAAGGCGCGCGGAAG

GCCGGCCACAGGCAT


Annealing temperature, cycle number

55°C, 38 cycles

61°C, 38 cycles


PCR product size in base pairs

326

111 or 139


Restriction enzyme (number of units) or size of ins/del

Hinf I (0.2), buffer 2

28 bp repeat visible by gel electrophoresis


Fragment sizes for common allele in base pairs.

Fragment sizes for rare allele in base pairs.

104 and 222

102, 166 and 53

139

111


Jennings et al. BMC Medical Genetics 2010 11:18   doi:10.1186/1471-2350-11-18

Open Data