Table 1

primer sets, melting temperature (MT), PCRs size and genotyping conditions are reported for associated SNPs in GRIA1 and GRIA3 genes.

GENE

SNP

PRIMERS

MT

SIZE

ENZYME

ALLELE 1 (size)

ALLELE 2 (size)


GRIA1

rs548294

AGATGAAGAAACAGAGGTC

56°C

311 bp

MwoI

C (123/188)

T (311)

CCCCAGGTACTATTCAAAG

GRIA1

rs2195450

TCTAAGAGGAGGGGGCAAGG

60°C

367 bp

TaqI

G (218/149)

A (367)

GCTTGGTAGATGGTGCTTGA

GRIA3

rs3761555

CTGGAACAATGGAACAAAAT

55°C

272 bp

BglII

T (272)

C (111/161)

ATAATGCTATGTCCCTGTCT


Formicola et al. BMC Medical Genetics 2010 11:103   doi:10.1186/1471-2350-11-103

Open Data