Table 1

Primer sequence used for real time RT-PCR

Gene

Accession number

upper

lower


Occludin

NM_002538

5' CATTGCCATCTTTGCCTGTG3'

5' AGCCATAACCATAGCCATAGC3'

Claudin1

NM_021101

5' CAGGCTACGACCGCAAC3'

5' CAGGCTACGCAAGGAC3'

Claudin2

NM_020384

5' CCCAAACCCACTAATCACATC3'

5' GCCACTGCTTCTCCTTCC3'

Claudin3

NM_001306

5' CAGGCTACGACCGCAAGGAC3'

5' GGTGGTGGTGGTGGTGTTGG3'

Claudin4

NM_001305

5' GGCGTGGTGTTCCTGTTG3'

5' AGCGGATTGTAGAAGTCTTGG3'

Claudin5

NM_003277

5' TACCGCAGGAAGAGGAGCAG3'

5' GCCCGAAGCAGCCAATCC3'

GAPDH

NM_002046

5' TCTCTGCTCCTCCTGTTC3'

5' CTCCGACCTTCACCTTCC3'


Bai et al. BMC Infectious Diseases 2008 8:77   doi:10.1186/1471-2334-8-77

Open Data