Table 1

Primers used in multi-locus sequence typing of Fusarium isolates collected from patients and the environment
Locus Gene product (size in bp) Primer Sequence 5’-3’ PCR Sequencing
EF-1α Translation elongation factor 1 alpha (716) EF1 ATGGGTAAGGARGACAAGAC x
EF2 GGARGTACCAGTSATCATG x
EF3 GTAAGGAGGASAAGACTCACC x
EF22T AGGAACCCTTACCGAGCTC x
rRNA Nuclear ribosomal rRNA (986) ITS5 GGAAGTAAAAGTCGTAACAAGG x x
ITS2 GCTGCGTTCTTCATCGATGC x x
ITS3 GCATCGATGAAGAACGCAGC x x
ITS4 TCCTCCGCTTATTGATATGC x x
NL4 GGTCCGTGTTTCAAGACGG x x
RPB2 RNA Polymerase beta subunit (1738) 5f2 GGGGWGAYCAGAAGAAGGC x
7cr CCCATRGCTTGYTTRCCCAT x
7cf ATGGGYAARCAAGCYATGGG x
11ar GCRTGGATCTTRTCRTCSACC x
F2F AAAGCTCGCCAAGCCCCGTC x
F1R GTCCTCTGGTGGCTCCGCCT x
40-2f CAAAAACCTCTGGCGACAAC x
40-r AGCTTGCGTCCAGTATGACC x

Letter designations for degenerate bases: R, A or G; S, C or G; W, A or T; Y, C or T.

Scheel et al.

Scheel et al. BMC Infectious Diseases 2013 13:49   doi:10.1186/1471-2334-13-49

Open Data