Table 1

List of primers used to amplify streptococcal superantigen genes, 16S ribosomal RNA (rRNA), and emm genes
Name Sequence 5′-3′ Source
SpeA forward AAAGTTGCCATCTCTTGGTTC Sigma genosys
SpeA reverse CAAGAGGTATTTGCTCAACAAGAC Sigma genosys
SpeC forward TTTGAGCAGGCGTAATTCCT Sigma genosys
SpeC reverse TTCAACGACACACACATTAAACA Sigma genosys
SpeG forward ACCCCATGCGATTATGAAAA Sigma genosys
SpeG reverse GGGAGACCAAAAACATCGAC Sigma genosys
SpeH forward ATTCCAATGTTGTTCAAGCAAA Sigma genosys
SpeH reverse TGAGCGGTTACTTTCGGTTT Sigma genosys
SpeI forward TCCGCCATTTTCAGGTAGTT Sigma genosys
SpeI reverse TTTCCTTCCTCAAAGCCAGA Sigma genosys
SpeJ forward GCTCTCGACCTCAGAATCAA Sigma genosys
SpeJ reverse CTTTCATGGGTACGGAAGTG Sigma genosys
SpeK forward CAAACAAGGAACGCAATTGAT Sigma genosys
SpeK reverse GTGTCTAATGCCACCGTCT Sigma genosys
SpeL forward ATAAGTCAGCACCTTCCTCTTTC Sigma genosys
SpeL reverse AAATCTCCCGTTACCTTCCA Sigma genosys
SpeM forward AACTTCTTCTTCCTTAAAGCGTCT Sigma genosys
SpeM reverse TGCTGTGTTGGTTAATAGCGA Sigma genosys
SmeZ forward TTTCTCGTCCTGTGATTGGA Sigma genosys
SmeZ reverse AATGGGACGGAGAACATAGC Sigma genosys
SSA forward ACAGGTCAGCTTTTACAGCA Sigma genosys
SSA reverse GGGCATCATATCGTACCAAA Sigma genosys
16S rRNA forward AGAGTTTGATCCTGGCTCAG Invitrogen life technologies
16S rRNA reverse AAGGAGGTGATCCAGCCGCA Invitrogen life technologies
emm genotyping primer forward TATTCGCTTAGAAAATTAA Invitrogen life technologies
emm genotyping primer reverse GCAAGTTCTTCAGCTTGTTT Invitrogen life technologies

Anantha et al.

Anantha et al. BMC Infectious Diseases 2013 13:381   doi:10.1186/1471-2334-13-381

Open Data