Table 1

Primers used for the detection of the presence of different beta lactamases genes by PCR
Amplicon Primer sequence (5to 3) Size (bp)
blaSHV GCCCGGGTTATTCTTATTTGTCGC 900 [16]
TCTTTCCGATGCCGCCGCCAGTCA
blaTEM ATAAAATTCTTGAAGACGAA 960 [17]
ATATGAGTAAGCTTGGTCTGACAG
blaCTX-M ATGTGCAGYACCAGTAARGT 593 [18]
TGGGTRAARTARGTSACCAGA
blaCTX-M-3/15/22 GTTACAATGTGTGAGAAGCAG 1000 [18]
AACGGAATGAGTTTCCCCATT
blaCTX-M gr 9 ATGGTGACAAAGAGAGAGTGCA 835 [19]
CCCTTCGGCGATGATTCTC
blaOXA-1 ACA CAA TAC ATA TCA ACT TCG C 813 [20]
AGT GTG TTT AGA ATG GTG ATC

Arnoldo et al.

Arnoldo et al. BMC Infectious Diseases 2013 13:124   doi:10.1186/1471-2334-13-124

Open Data