Table 1

Sequences of primer sets and restriction enzymes used to characterized polymorphisms
Genes, Codons Primer names Primers T°C Restriction enzyme sizes (bp)*
Pfmdr1, N86Y mdr86D1 TTTACCGTTTAAATGTTTACCTGC 45 Afl III 126 +165
mdr86D2 CCATCTTGATAAAAAACACTTCTT
Pfmdr1, D1246Y, mdr1246D1 AATGTAAATGAATTTTCAAACC 45 Bgl II 113 + 90
mdr1246D2 CATCTTCTCTTCCAAATTTGATA
ATPase 6, G110A ATP6-110F CGTTGAACTTATTATATCTTTGTC 60 Mbo II 103+94+92+40
ATP6-110R TTTCATATCTAATAAAGTTAACACG
ATPase 6, A2694T ATP6-2694F GAATTGTTTTCTGTAGAACTGAAC 55 Tas I 142 + 39
ATP6-2694R ATCTGATGCTTCTTTAGCTACC
Pfcrt, C72S CRT72MS TTTATATTTTAAGTATTATTTATTTAAGTGGA 55 Mbo I 55 + 38
76-D2 CAAAACTATAGTTACCAATTTTG
Pfcrt, M74I CRT745MS TAAGTATTATTTATTTAAGTGTATGTGTCAT 55 Nla III 53 + 31
76-D2 CAAAACTATAGTTACCAATTTTG
Pfcrt, N75M CRT745MS TAAGTATTATTTATTTAAGTGTATGTGTCAT 50 BspHI 53 + 31
76-D2 CAAAACTATAGTTACCAATTTTG
Pfcrt, 76 Pfcrt-76A GCGCGCGCATGGCTCACGTTTAGGTGGAG 55 Apo I 136 + 56
Pfcrt-76B GGGCCCGGCGGATGTTACAAAACTATAGTTACC

sizes* indicate the sizes of fragments generated after restriction enzyme digestions.

AA1 = mutation on amino acid sequence.

T°C = hybridization temperature during PCR programme.

Zatra et al.

Zatra et al. BMC Infectious Diseases 2012 12:307   doi:10.1186/1471-2334-12-307

Open Data