Table 2

Nucleotide primer sets used for the ompB LAMP assay
Primer type Positions Sequence 5-3
FIP(F1c-F2) 1287-1308/1230-1247 GTCACCGCAACATTTGCATCTG-GTAACACTGCAGGTGTGAT
BIP(B1c-B2) 318-1339/1373-1390 TACAGCAATTGAAGCATCAGGT-TCCTAAACGTAACTCGGC
F3 1210-1227 AGGTGATGCTAIIAATCC
B3 1410-1427 CTGTACCITCAGCAAGTT
LF 1263-1285 ACTAGCACTTGCTAAAGTACCGT
LB 1346-1370 GTTGTCCAATTATCAGGAACACATG

Pan et al.

Pan et al. BMC Infectious Diseases 2012 12:254   doi:10.1186/1471-2334-12-254

Open Data