Table 4

Details of the primers used in this study.

Sequence ID

Annotation

Sense Primer 5----3

Anti-sense Primer 5---3

Amplicon (bp)


HLCDTotal.seq.Contig101:60-443

No hit

AAAGGGAAGTCCACACAGCC

CGAAACCACAAACTCCAAATCAAC

199

HLCDTotal.seq.Contig852:60-447

No hit

ACGCAAGAGGGAAAGAGAAG

GGGGAGCATAGTCTACTCCA

92

HLCDTotal.seq.Contig750:60-307

Osmotin-like protein TPM-1 precursor (PR P23) (Fragment)

TAATAGAGGCTTTATGGGCAGAA

CTGATGCTTACAGCTACCCTAA

100

HLCDTotal.seq.Contig748:60-265

NP24 protein precursor (Pathogenesis-related protein PR P23)

GCAGAAGATAACATCATAGTTGGT

CCCTACAGAATACTCAAGGTATTT

121

L11_67_Sh_CT_P1_F08.ab1:60-295 1 295

Mitogen-activated protein kinase kinase MAPKK

ATTGTTTACAGATGAACGGATGCG

AGGGCGTATCGGAGGAGTTC

111

HLCDTotal.seq.Contig732:60-421

Metallothionein-like protein

TGCAGCCATTTCCGCATTTG

GCTCCTCAGAGAAAGCCACC

144

HLCDTotal.seq.Contig710:60-206

SOS2-like protein kinase

AGGAAGATCTACAGAGGAGACTTT

TGGTTGGATCGAGGAGTTTCG

88

HLCDTotal.seq.Contig935:60-374

Putative metallothionein-like protein

GCTATGTTGGGACCGTTGTGA

GCCACAGGTGCAGTCAATACA

98


Lin et al. BMC Plant Biology 2007 7:8   doi:10.1186/1471-2229-7-8

Open Data