Table 2

Description of poplar genes and primers for real-time PCR.

Namea

GenBank accession numberb

Arabidopsis homolog locusc

Arabidopsis locus description

BLASTX score/ E value

Primer sequences (forward/reverse)


ACT11

    CA824001

    AT3G12110

Actin 11

363/ e-101

CACACTGGAGTGATGGTTGG / ATTGGCCTTGGGGTTAAGAG

ACT2

    BU879695

    AT5G09810

Actin 2/7

320/ 5e-088

CCCATTGAGCACGGTATTGT / TACGACCACTGGCATACAGG

CYP

    BU875027

    AT2G21130

cyclophilin (CYP2)

284/ 6e-077

GGCTAATTTTGCCGATGAGA / ACGTCCATCCCTTCAACAAC

TUA

    CA822230

    CA825391

    AT5G19780

tubulin alpha-3/alpha-5 chain

439/ e-130

AGGTTCTGGTTTGGGGTCTT / TTGTCCAAAAGCACAGCAAC

TUB

    CA824237

    AT4G20890

tubulin beta-9 chain

154/ 4e-038

GCACCAACTTGTTGAGAATGC / TTTCAACTGACCAGGGAACC

UBQ

    BU879229

    AT4G05050

polyubiquitin (UBQ11)

416/ e-117

GTTGATTTTTGCTGGGAAGC / GATCTTGGCCTTCACGTTGT

UBQ-L

    BU871588

    AT2G35635

ubiquitin-like (UBQ7)

291/ 4e-079

TGAGGCTTAGGGGAGGAACT / TGTAGTCGCGAGCTGTCTTG

EIF4B-L

    CA825614

    AT4G38710

similarity to eukaryotic translation initiation factor 4B

80/ 1e-015

AAAAAGGGGATTTGGGATTG / AACTTCGTCCTCGGTAGCAA

EF1β

    BI125345

    AT2G18110

elongation factor 1-beta, putative

122/ 1e-028

AAGAGGACAAGAAGGCAGCA / CTAACCGCCTTCTCCAACAC

18S

    AF206999

    18RRNA

18S ribosomal RNA

2949/ 0.0

AATTGTTGGTCTTCAACGAGGAA/ AAAGGGCAGGGACGTAGTCAA


aAll poplar sequences except 18S are ESTs, and were named based on similarity to Arabidopsis proteins determined via BLASTX (Altschul et al. 1997). In most cases, the name indicates only a gene family or subfamily rather than a specific member of a gene family because partial poplar sequences and BLAST will not necessarily identify the putative Arabidopsis ortholog. bTwo accession numbers indicate that two EST sequences were used to design the primer set. cClosest Arabidopsis homolog identified using Tair BLAST 2.0 http://www.arabidopsis.org/Blast/ webcite. AGI proteins database was queried with poplar nucleotide sequences using BLASTX or in the case of 18S, Arabidopsis genome database with BLASTN.

Brunner et al. BMC Plant Biology 2004 4:14   doi:10.1186/1471-2229-4-14

Open Data