Table 4

Primers used for real-time PCR analysis
Gene Forward primer (5’ to 3’) Reverse primer (5’ to 3’) Product (bp)
LcAtpB GAGAGTTGGTTTGACTGCCCTAA GAAGGCATTCTACCCAATAAGGC 141
LcAOX1 TCGGCTATCACTAAGATGTTGGTCA ACAAGCACACACTCAACGGATTTAC 149
LcUCP1 AGTTGGCGGTGATTTTATTGGAG GCATTCAAGGTCCCATAATAACG 177
LcAAC1 CTGAAGAATGAGGGTGCCAAGTC CTAAAACAGCGAAAGGAATACCG 171
LcSnRK2 AGTTGAAGGACATCTGCTTGGAA ATGCGAAAACCATACCTGTGTCA 153

See legend for Table 2 for names of genes.

Wang et al.

Wang et al. BMC Plant Biology 2013 13:55   doi:10.1186/1471-2229-13-55

Open Data