Table 2

Molecular markers and the phenotypic variation they explain in the two F2 populations studied
Marker Marker, Mt chromosome Primer sequence (forward and reverse, 5’ – 3’) Restriction enzyme Expected CAPS fragment size [bp] Phenotypic variation explained [%]
tap Par/Cal t x P* t x C**
MTIC348 SSR, chr. 4 TGGAGGAGGGGTAGGATAGG ATGATGATGAGGCGGAGAAG - - - 95 94
h2_13f22h SSR, chr. 4 GGCTTCCTGATGCTGGTTAG ACAAGCAGGTTGGACACACA - - - 95 94
h2_6e22a SSR, chr. 4 CCATGGTGTCATTTGATCCT CCATGGTGTCATTTGATCCT - - - 96 n.p.
MtBtol-1 CAPS (gene), chr. 4 CTCTTTACCTCCCCCTCCTG TTGAACTACGATCAGGGTCGTTCCTA ApoI 387 170/217 96 94
MtBtol-2 CAPS (gene), chr. 4 TTGAACTACGATCAGGGTCGTTCCTA TGCTCCAGCACATCCAATTA DraI 102/131 102/256 96 94
256/280 411
MtBtol-3 CAPS (gene), chr. 4 TCCCACTGAAAATCGATTCAA GGCCAAAGCTCATTCCATT MspI 125/450 575 96 94
h2_21b19a SSR, chr. 4 GGAACACCGGACACAATACC CACTTCTCAGGCACAGCAAA - - - 96 n.p.
001D02 SSR, chr. 4 TCCCAACGCTTTTTCATTTC GAACTTGAAGAAGAACGCCG - - - 94 89
MtChr7 CAPS, chr. 7 TTGGAGCATTTATACCAGCAA TTGTATGCATCGGAGACTGC NlaIII 306 84/222 n.a. n.a.
002G04 SSR, chr. 1 AGGGTCGCCTCAACTATTA TCAACACCATTTTCTCAATG - - - n.a. n.a.
002G02 SSR, chr. 1 TAACGTTACTCCCTCCTCCG TCTCCAACGAAGTTCAAGGG - - - n.a. n.a.
h2_13c11a SSR, chr. 1 TCACAACCTTCTTGCACCAG TCATAACTTGACCTGCACCA - - - n.a. n.a.

Most closely linked markers are in bold font. * n = 200; ** n = 36; n.a., not applicable; n.p., not polymorphic.

Bogacki et al.

Bogacki et al. BMC Plant Biology 2013 13:54   doi:10.1186/1471-2229-13-54

Open Data