Table 1

Mal d 1 specific primer pairs for qRT-PCR analysis
Gene Primer name Sequence 5′-3′ SNP consa SNP geneb SNP allelec Start position Length (bp) Primer conc. Ta Tm Slope
Mal d 1.01 qMd1.01/02F GATTGAAGGAGATGCTTTGACA 5 - - 258 103 100 63 80.5 −0.079
qMd1.01R
    G
TAATGACTGATGCTCTTGATGG
- 1 1
Mal d 1.02 qMd1.01/02F GATTGAAGGAGATGCTTTGACA 4 - - 258 111 100 62 81.0 −0.206
qMd1.02R TTGGTGTGGTAGTGGCTGATA 1 1 -
Mal d 1.03A qMd1.03AF ATCTGAGTTCACCTCCGTCATT 1 2 - 21 96 70 63 81.0 −0.057
qMd1.03AR ACTGCTTGTGGTG
    G
AATCTTT
- 1 1
Mal d 1.03B qMd1.03BF TGTTTTCACATACGAATCCGAA 1 1 - 6 167 100 63 83.5 −0.570
qMd1.03BR TGATCTTCTTAATGGTTCC
    T
ACGC
1 1 1
Mal d 1.03C qMd1.03CF CTC
    C
GAAACAATTGAGAAAATCTG
3 - 1 276 79 100 63 80.5 −0.120
qMd1.03CR GCTGGTGCTCTTGATGATGC 1 1 -
Mal d 1.03D qMd1.03D/EF ATACGAATCCGAGTTCACCTCT 1 - - 15 156 70 62 83.0 0.005
qMd1.03DR ATCTTCTTAATGGTTCCAACTCCT 1 1 -
Mal d 1.03E qMd1.03D/EF ATAC
    G
AATCC
    G
AGTTCACCTCT
1 - 2 15 169 70 62 83.0 −0.116
qMd1.03ER TTCACCGAAGTTGATCTTCTTAATA 1 1 -
Mal d 1.03F qMd1.03FF CACAGAATTGACGGGGTG 2 2 - 208 119 70 63 81.0 −0.122
qMd1.03FR CC
    G
GAAGCGACCAACTTA
2 1 1
Mal d 1.03G qMd1.03GF ATTATCAAGAGCACCAGTCACTACT 2 2 - 337 122 70 62 81.0 −0.254
qMd1.03GR TCCAAGAGGTAGTTCTCAATCAA 1 - -
Mal d 1.03H qMd1.03HF AAAATCTGCTACGAGACTAAGTTGA 3 2 - 277 173 100 61 83.5 −0.431
qMd1.03HR TGGTGCTCCAAGAGGTAGTTT 1 1 -
Mal d 1.03I qMd1.03IF CCCCAAGATTGCACCACAT - 1 - 93 228 100 61 81.5 −0.230
qMd1.03IR GCCACCAACTTAGTCTCGTAACAA 2 1 -
Mal d 1.03J qMd1.03JF GCATCACCCACTACCACACA 2 1 - 347 134 70 61 82.0 −0.105
qMd1.03JR CGAGCTGTAGGAGTCTTGGTT 3 3 -
Mal d 1.03K qMd1.03KF CATCAGCCACTACCACACAAA 2 1 - 348 128 100 61 81.5 −0.431
qMd1.03KR TGTA
    T
GCATCCTGGTGCTCT
2 1 1
Mal d 1.04 qMd1.04F GGGTATGTTAAGCAAAGGGTCA 5 2 - 196 193 100 61 80.5 −0.103
qMd1.04R TGATCTCAACATCACCCTTAGC 1 1 -
Mal d 1.05 qMd1.05F ATCAAACCAC
    T
AGTCACTGCCAT
4 1 1 343 124 70 63 82.5 −0.141
qMd1.05R GGTTGGCCACAAGGTAGGTT 6 1 -
Mal d 1.06A qMd1.06AF CTATAGCTATAGCTTGATTGAAGGG 5 1 - 243 167 100 61 80.5 −0.203
qMd1.06AR TTCCA
    A
CCTTAACATGTTCTTCT
3 - 1
Mal d 1.06B qMd1.06BF AAACCGAATACG
    C
ATCCATT
3 3 1 20 106 100 61 81.5 −0.012
qMd1.06BR ACAGTTTTGACTGCTTGTGGAG 6 - -
Mal d 1.06C qMald1.06CF GCTCCACAAGCAGTCAAAACT 5 - - 103 116 70 63 80.5 −0.250
qMald1.06CR TCAACCTTGTGCTTCACATAACTA 3 2 -
Mal d 1.06D qMd1.06DF CCCTCCTGCTAGGTTGTATT 2 2 - 42 100 70 61 80.5 −0.005
qMd1.06DR TCCCTCGAGAATTTCAACAG 6 - -
Mal d 1.07 qMd1.07F CAACTTTGTGTACCA
    G
TACAGTGTC
2 2 - 234 126 100 61 81.5 −0.201
qMd1.07R TAGTGGCTGATGCTCTTGATAAC 2 1 -
Mal d 1.08 qMd1.08F TCTTCGGTGAAGGTAGCACAA - 2 - 173 200 100 61 81.5 −0.390
qMd1.08R ACCCTTAGTGTGGTAGTGGCAT 1 2 -
Mal d 1.09 qMd1.09F TTTTCACATACGAATCCGAGTC - 1 - 8 126 100 61 84.0 −0.265
qMd1.09R GGATCTCAACGCTCTTCACA 2 1 -
Mal d 1.10. qMald1.10F CAAGGCTTTCATCC
    A
CGAC
5 2 1 60 157 100 61 83.0 −0.158
qMald1.10R GATTCTGTGCTTTACAAACCCT 4 3 -
Mal d 1.11A qMald1.11AF GGAGGATGCATCTGTCATTTG 11 1 - 343 130 100 62 79.5 −0.018
qMald1.11AR CCATGAGATAGGCTTCCAAAACT 8 2 -
Mal d 1.11B qMd1.11BF CAGCACATACAAAGCCAAAGAC 8 1 - 363 125 100 61 81.0 −0.106
qMd1.11BR TTTATGCGCGAGGGTGTG 6 1 -
Mal d 1.12 qMd1.12F GCTTACACTTTGGTTGAAGGAGAAC 4 3 - 247 171 100 62 76.0 −0.227
qMd1.12R CCTGCCAGCTTTTATTTCTTCC 5 4 -
Mal d 1.13A qMd1.13AF GTGTTGGAACCATCAAGAAGATTAG 2 2 - 149 124 100 61 78.0 −0.216
qMd1.13AR ACATCTCCTTCAATCAAACTGTAAT 1 1 -
Mal d 1.13B qMd1.13BF CGAAGATAACTTTGTCTACAACCAT 2 1 - 258 137 70 61 81.5 0.003
qMd1.13BR GCTCTTCCTTGATCTCAACATCTT 1 1 -
Mal d 1.13C qMd1.13CF GAATTCGCCTCAGTCTCCA 5 1 - 25 186 70 61 82.0 0.087
qMd1.13CR GTGCTTCACATAGCTGTATTCACTT 3 1 -
Mal d 1.13D qMd1.13DF TGTTGGAACCATCAAGAAGATAAGT 2 1 - 150 124 100 61 78.5 −0.163
qMd1.13DR GACATCTCCTTCAATCAAACTGTAG 2 1 -
Mal d 1.14 qMd1.14F GGTGAAGGGAGTGAATACAACTATA 6 1 - 178 185 100 61 79.0 −0.470
qMd1.14R TGGTA
    A
TGGCT
    A
ATGTTCTTGATAC
2 2 2

aSNPs to the consensus sequence showed in bold; bgene-differentiating SNPs showed in italics and callele-differentiating SNPs showed by underlining. The last column contains the slopes of the curves obtained by plotting log input vs ΔCt (Ct Mal d 1 gene - Ct actin). The values between −0.1 and 0.1 are underlined.

Pagliarani et al.

Pagliarani et al. BMC Plant Biology 2013 13:51   doi:10.1186/1471-2229-13-51

Open Data