Table 4

Primers used
Primers Gene name Sequence (5′..3′)
BBPL0078F FATA CACTATACATAACCCACTCCGTACC
BBPL0136R FATA TTAACAAAAACCTAACCTGCAACAG
BBPL0138F FATA TGATGCATTTAGATGATGAATTTTG
BBPL0078R FATA AAAAGAAAGAACCGTGTTATCAGAG
BBPL0080F FATA TGAAATTTACAGATATCCTGCTTGG
BBPL0080R FATA GGATAAAAATGGCAAGATTTCAAAC
BBPL0082F FATA AAAGACTGAATTGCCCAAGTTTAC
BBPL0082R FATA CTATATCCCAGAATAGGCGAAATG
BBPL0146F_IRD700 FATA CAAAACCTTCACACCTAACCTTTTC
BBPL0146R_IRD800 FATA GTCTTATTAATCCCGACCTCATAAC
BBPL0147F_IRD700 FATA CGTATTATAGGAGGTAGGAGGAAATC
BBPL0147R_IRD800 FATA ATATCGTCATTGACTTTCTGGAGTC
BBPL0107F_IRD700 FATA ATCAAAGATCATTCCAATGGTGAG
BBPL0107R_IRD800 FATA ACGAATGGCATTTTACTCTTCTTG
BBPL0090F_IRD700 FATA AAATTCGATGGAGTTAACGAGCTG
BBPL0090R_IRD800 FATA AAGGATAAATACGAAACACAGATGC
BBPL0039F SAD AGACGTTGTTGACGTGAAACAC
BBPL0039R SAD CCATGGAAAGCAACAGAACC
BBPL0069F_IRD700 SAD TTTGGGCGACTTATTTAATGC
BBPL0069R_IRD800 SAD CTTGTTTTTTCAGAGCTTCAC

Kumar et al.

Kumar et al. BMC Plant Biology 2013 13:38   doi:10.1186/1471-2229-13-38

Open Data