Table 1

Primers used for the expression analysis of phenylpropanoid pathway genes by using RT q-PCR [[14]]
Gene abbreviation Gene definition Gen Bank accession Unigene ID Primer pair
5-Forward-3/5-Reverse-3
STS1 Stilbene synthase 1 DO366301 Vvi.8 CGAAGCAACTAGGCATGTGT/
CTCCCCAATCCAATCCTTCA
PAL1 Phenylalanine ammonialyase EC987386 Vvi.1950 CCGAACCGAATCAAGGACTG/
GTTCCAGCCACTGAGACAAT
C4H1 Cinnamate-4-hydroxylase EC995763 Vvi.6228 AAAGGGTGGGCAGTTCAGTT/
GGGGGGTGAAAGGAAGATAT
4CL1 4-coumarate-CoA ligase EC947790 Vvi.1251 CTGATGCCGCTGTTGTTTCG/
GCAGGATTTTACCCGATGGA
CHS1 Chalcone synthase1 EC996578 Vvi.117 GTCCCAGGGTTGATTTCCAA/
TCTCTTCCTTCAGACCCAGTT
CCR2 Cinnamoyl-CoA reductase CF517687 Vvi.15864 ACAGCATGACGACTCTCTTCG/
AGTGACAAGGGGTGGATTGA

Boubakri et al.

Boubakri et al. BMC Plant Biology 2013 13:31   doi:10.1186/1471-2229-13-31

Open Data