Table 4

List of CAPS markers polymorphic between Arabidopsis ecotypes Col-0 and Nd-0
CAPS marker 1Restriction enzyme 2Primers
1H1L-1.6 Rsa I, Tsp509I F:CTAGAGCTTGAAAGTTGATG
R:TTGAGTCCTTCTTGTCTG
20B4L-1.6 DdeI F:CTAAGATGGGAATGTTGG
R:GAACTCATTGTATGGACC
40E1T7 AccI F:GGTCCACTTTGATTCAAGAT
R:GCAAGCGATAGAACATAACG
AF2 DdeI F:TCGTCGTTTTTGTTTCCTTTTTCTTA
R:CCATTCATTTAGGCCCCGACTTTC
B9-1.8 TaqI F:CATCTGCAACATCTTCCCCAG
R:CGTATCCGCATTTCTTCACTGC
CAT TaqI, Tsp509I F:GACCAGTAAGAGATCCAGATACTGCG
R:CACAGTCATGCGACTCAAGACTTG
ER DdeI F:GAGTTTATTCTGTGCCAAGTCCCTG
R:CTAATGTAGTGATCTGCGAGGTAATC
G4026 TaqI, RsaI F:GTACGGTTCTTCTTCCCTTA
R:GGGGTCAGTTACATTACTAGC
G4711 DdeI F:CCTGTGAAAAACGACGTGCAGTTTC
R:ACCAAATCTTCGTGGGGCTCAGCAG
GPA1.1 Tsp509I F:ATTCCTTGGTCTCCATCATC
R:GGGATTTGATGAAGGAGAAC
JM411 DdeI F:GCGAACCACTAAGAACTA
R:CTCGACTTTGCCAAGGAT
LFY3 RsaI F:GACGGCGTCTAGAAGATTC
R:TAACTTATCGGGCTTCTGC
MI342 Tsp509I F:GAAGTACAGCGGCTCAAAAAGAAG
R:TTGCTGCCATGTAATACCTAAGTG
M555 AccI F:CCTTTAATTAGTTATCAAATC
R:CTCTTGAATTATTAAGTTGACTAG
M59 RsaI, Tsp509I F:GTGCATGATATTGATGTACGC
R:GAATGACATGAACACTTACACC
MBK23A TaqI F:GATGATTAGGCGCAAAATTGAG
R:ATTACCAGCCTGGCTTCAGG
PAI1.1 TaqI, RsaI, Tsp509I F:GATCCTAAGGTATTGATATGATG
R:GGTACAATTGATCTTCACTATAG
T20D161 TaqI, RsaI, Tsp509I F:CGTATTTGCTGATTCATGAGC
R:ATGGTTTACACTTGACAGAGC
T6P5-4.8 RsaI F:TGAAAGACACCTGGGATAGGC
R:CCAACTTTCGGGTCGGTTCC

1Restriction endonucleases used for individual CAPS markers are shown. 2Primers: F, forward primer; R, reverse primer

Sumit et al.

Sumit et al. BMC Plant Biology 2012 12:87   doi:10.1186/1471-2229-12-87

Open Data