Table 3

Primers used in the RT-PCR experiment
Gene 1Primer Amplicon
PsAvh223 F:GGCCACCCACACACCCCTCCCTCCCGTC 237
R:CGGCGTCCTCGGCCTCGTCGTCTAG
PsAvh224 F:GCGCGGCCTCGAGTTCCTTCTTCGTG 355
R:CCTCCCTCCCGTCCGCTACAGTCATG
AtActin F:GGCGATGAAGCTCAATCCAAACG 491
R:GGTCACGACCAGCAAGATCAAGACG

1Primers: F, forward primer; R, reverse primer

Sumit et al.

Sumit et al. BMC Plant Biology 2012 12:87   doi:10.1186/1471-2229-12-87

Open Data